Incidental Mutation 'R9378:Whrn'
ID 709766
Institutional Source Beutler Lab
Gene Symbol Whrn
Ensembl Gene ENSMUSG00000039137
Gene Name whirlin
Synonyms C430046P22Rik, Dfnb31, wi, 1110035G07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9378 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 63414910-63495991 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63431842 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 546 (H546R)
Ref Sequence ENSEMBL: ENSMUSP00000065838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063650] [ENSMUST00000063672] [ENSMUST00000084510] [ENSMUST00000095037] [ENSMUST00000095038] [ENSMUST00000102867] [ENSMUST00000107393] [ENSMUST00000119294]
AlphaFold Q80VW5
Predicted Effect probably benign
Transcript: ENSMUST00000063650
SMART Domains Protein: ENSMUSP00000069664
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 824 904 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063672
AA Change: H546R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065838
Gene: ENSMUSG00000039137
AA Change: H546R

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084510
SMART Domains Protein: ENSMUSP00000081557
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
PDZ 835 915 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095037
SMART Domains Protein: ENSMUSP00000092647
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
PDZ 321 401 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095038
SMART Domains Protein: ENSMUSP00000092648
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
PDZ 393 473 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102867
SMART Domains Protein: ENSMUSP00000099931
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 823 903 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107393
SMART Domains Protein: ENSMUSP00000103016
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 1.7e-23 SMART
PDZ 289 361 1.8e-21 SMART
low complexity region 526 545 N/A INTRINSIC
low complexity region 633 646 N/A INTRINSIC
PDZ 828 908 1.3e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119294
SMART Domains Protein: ENSMUSP00000114030
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
PDZ 382 462 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144965
SMART Domains Protein: ENSMUSP00000121944
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
PDB:1UF1|A 16 74 7e-33 PDB
SCOP:d1lcya1 32 74 1e-7 SMART
Blast:PDZ 40 74 5e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein required for elongation and actin polymerization in the hair cell stereocilia. The encoded protein is localized to the cytoplasm and co-localizes with the growing end of actin filaments. Mutations in this gene have been linked to deafness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Spontaneous mutants lacking both isoforms show short stereocilia, severe deafness and vestibular deficits. Targeted homozygotes lacking the long form show altered OHC stereocilia bundles but a milder phenotype with normal stereocilia in IHCs and a subset of vestibular HCs and no vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2210408I21Rik A G 13: 77,323,616 K1047E possibly damaging Het
Abca14 A T 7: 120,207,968 Y79F possibly damaging Het
Abca2 T A 2: 25,439,082 M978K probably benign Het
Adamts3 A T 5: 89,700,410 C684* probably null Het
Adnp2 T C 18: 80,129,422 T591A probably benign Het
Aff4 A T 11: 53,372,479 T109S probably damaging Het
Agmo A G 12: 37,243,721 I48V probably benign Het
Appl1 G A 14: 26,927,827 R581* probably null Het
Armc9 A T 1: 86,262,044 M714L probably benign Het
Atp6v0d2 T A 4: 19,922,377 T41S probably benign Het
Bin1 A T 18: 32,419,868 Q182L probably damaging Het
Bmp10 A G 6: 87,433,702 D159G probably benign Het
Bsn G A 9: 108,107,655 P295S possibly damaging Het
C130079G13Rik A G 3: 59,931,689 T11A possibly damaging Het
Cbx6 A G 15: 79,828,405 S274P probably damaging Het
Cdc20b A G 13: 113,056,097 K108R probably benign Het
Ces1d T A 8: 93,186,096 N238I probably damaging Het
Col7a1 C T 9: 108,958,640 Q663* probably null Het
Cpsf3 T C 12: 21,308,038 I517T possibly damaging Het
Cyp2a5 C A 7: 26,840,454 T309N probably damaging Het
Cyp2d40 A G 15: 82,761,601 F68L possibly damaging Het
Cyp7b1 A T 3: 18,096,673 W301R probably damaging Het
Dnah6 T A 6: 73,212,530 N45I probably benign Het
Dnah7a A T 1: 53,582,617 H1116Q probably benign Het
Dntt A G 19: 41,038,917 N141S probably benign Het
Fbxl13 T C 5: 21,585,203 N281D probably damaging Het
Frem2 A T 3: 53,651,989 L1699H probably damaging Het
Gabrr3 T C 16: 59,461,674 V464A possibly damaging Het
Gdap1 T A 1: 17,157,129 I160N probably damaging Het
Hnrnpll C A 17: 80,061,862 R44L unknown Het
Hsp90ab1 T C 17: 45,570,754 E187G probably damaging Het
Ighm T A 12: 113,422,590 T47S Het
Itgb7 A C 15: 102,227,396 probably null Het
Kif16b A T 2: 142,619,818 C1293* probably null Het
Klf11 C T 12: 24,655,044 R166C probably benign Het
Lca5l T A 16: 96,176,012 Q198L probably damaging Het
Lnx2 A T 5: 147,024,370 M584K probably benign Het
Lpp A T 16: 24,721,987 M1L probably benign Het
Lrig3 A G 10: 125,997,084 T276A probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Megf8 A T 7: 25,340,415 probably null Het
Myh1 A C 11: 67,202,433 T117P probably damaging Het
Neb C A 2: 52,244,101 R3290L possibly damaging Het
Neb A C 2: 52,247,292 V220G Het
Nktr A T 9: 121,748,198 K444I probably damaging Het
Nol11 A T 11: 107,173,679 M483K probably benign Het
Npy1r C A 8: 66,704,209 P94T probably damaging Het
Nsmaf T C 4: 6,440,940 T37A probably benign Het
Olfr1137 C A 2: 87,711,079 V276F possibly damaging Het
Olfr1224-ps1 T C 2: 89,157,055 N40S probably damaging Het
Olfr131 G A 17: 38,082,165 A271V possibly damaging Het
Olfr160 A G 9: 37,712,177 I34T probably damaging Het
Olfr286 A G 15: 98,227,039 L204P possibly damaging Het
Olfr624 A T 7: 103,670,182 M283K probably damaging Het
Olfr884 G A 9: 38,047,479 V86M possibly damaging Het
Palld C T 8: 61,516,657 R1211H unknown Het
Pcdha3 A G 18: 36,947,231 D342G probably damaging Het
Pclo G A 5: 14,765,863 V1266I Het
Pcnx4 T C 12: 72,555,890 Y309H probably damaging Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Pdzrn3 T G 6: 101,150,811 K965Q probably damaging Het
Phldb1 G A 9: 44,704,128 A225V probably benign Het
Plat A G 8: 22,775,583 Y214C probably damaging Het
Plppr1 T A 4: 49,325,627 C274* probably null Het
Poglut1 A G 16: 38,526,771 F345L possibly damaging Het
Ppara A T 15: 85,777,636 E26V possibly damaging Het
Ppcdc A T 9: 57,420,288 W79R probably damaging Het
Prdm1 C T 10: 44,440,154 C662Y probably damaging Het
Sgms2 G A 3: 131,342,362 probably benign Het
Slc31a1 T A 4: 62,388,606 M133K probably damaging Het
Smg1 G A 7: 118,178,775 Q1309* probably null Het
Sos1 T C 17: 80,453,810 I152M probably damaging Het
Stk4 A T 2: 164,110,216 probably benign Het
Syne1 T G 10: 5,250,954 N3538T probably damaging Het
Tbc1d16 A G 11: 119,208,840 F236S probably damaging Het
Tgs1 T A 4: 3,595,475 M548K probably benign Het
Twf1 G A 15: 94,585,455 T124I probably damaging Het
Tyro3 G A 2: 119,812,167 G611R probably damaging Het
Unc13b T A 4: 43,173,282 I1370K unknown Het
Usp40 A G 1: 87,957,310 W939R probably damaging Het
Vamp8 A T 6: 72,385,571 V82E probably damaging Het
Vmn2r17 A G 5: 109,427,866 H201R possibly damaging Het
Yeats2 T C 16: 20,214,478 V1036A probably benign Het
Zfp352 T G 4: 90,224,338 N238K probably benign Het
Zfp36l3 TCCAGGGGCGAGGGCAGCCCCAGGAGCAAGGGCCGCCCTAGGAATGAGGGCCGCCCCAGG TCCAGG X: 53,774,554 probably benign Het
Zfp462 T A 4: 55,011,510 S1159T probably benign Het
Zscan4-ps1 A T 7: 11,066,265 H232Q probably benign Het
Other mutations in Whrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Whrn APN 4 63472778 missense probably damaging 1.00
IGL01643:Whrn APN 4 63416435 missense possibly damaging 0.79
IGL02065:Whrn APN 4 63418585 missense possibly damaging 0.52
IGL02119:Whrn APN 4 63435487 missense probably damaging 0.99
IGL02589:Whrn APN 4 63418097 nonsense probably null
IGL02638:Whrn APN 4 63419472 missense possibly damaging 0.47
IGL02865:Whrn APN 4 63415492 missense probably benign 0.08
IGL02934:Whrn APN 4 63416105 missense probably damaging 1.00
IGL03372:Whrn APN 4 63418618 missense probably damaging 0.96
R0090:Whrn UTSW 4 63432732 missense possibly damaging 0.79
R0592:Whrn UTSW 4 63415567 missense probably damaging 1.00
R0631:Whrn UTSW 4 63419489 missense probably damaging 1.00
R1916:Whrn UTSW 4 63494732 missense probably damaging 1.00
R1933:Whrn UTSW 4 63415639 nonsense probably null
R1958:Whrn UTSW 4 63435429 missense possibly damaging 0.62
R2255:Whrn UTSW 4 63418148 missense possibly damaging 0.92
R2513:Whrn UTSW 4 63435412 missense probably benign 0.22
R3699:Whrn UTSW 4 63461412 splice site probably benign
R3919:Whrn UTSW 4 63495184 nonsense probably null
R4016:Whrn UTSW 4 63415639 nonsense probably null
R4241:Whrn UTSW 4 63432973 unclassified probably benign
R4517:Whrn UTSW 4 63461280 critical splice donor site probably null
R4739:Whrn UTSW 4 63418165 missense probably damaging 1.00
R5207:Whrn UTSW 4 63432714 missense probably damaging 1.00
R5281:Whrn UTSW 4 63418427 missense probably benign 0.04
R5307:Whrn UTSW 4 63431843 missense probably benign 0.01
R5463:Whrn UTSW 4 63432816 missense probably benign 0.08
R5663:Whrn UTSW 4 63418448 missense probably damaging 0.98
R5754:Whrn UTSW 4 63416588 missense probably damaging 0.98
R5933:Whrn UTSW 4 63494708 missense probably damaging 1.00
R6212:Whrn UTSW 4 63494686 nonsense probably null
R6380:Whrn UTSW 4 63418592 missense possibly damaging 0.90
R6381:Whrn UTSW 4 63472684 missense probably benign 0.00
R7030:Whrn UTSW 4 63495131 unclassified probably benign
R7350:Whrn UTSW 4 63431959 missense possibly damaging 0.71
R7382:Whrn UTSW 4 63418336 missense probably benign
R7419:Whrn UTSW 4 63416093 missense possibly damaging 0.94
R8334:Whrn UTSW 4 63494810 missense probably damaging 1.00
X0009:Whrn UTSW 4 63431911 missense probably benign 0.00
Z1176:Whrn UTSW 4 63415566 missense probably damaging 1.00
Z1177:Whrn UTSW 4 63418499 missense probably benign 0.00
Predicted Primers
Posted On 2022-04-18