Incidental Mutation 'R9378:Whrn'
ID 709766
Institutional Source Beutler Lab
Gene Symbol Whrn
Ensembl Gene ENSMUSG00000039137
Gene Name whirlin
Synonyms 1110035G07Rik, wi, Ush2d, Dfnb31, C430046P22Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9378 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 63333147-63414228 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63350079 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 546 (H546R)
Ref Sequence ENSEMBL: ENSMUSP00000065838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063650] [ENSMUST00000063672] [ENSMUST00000084510] [ENSMUST00000095037] [ENSMUST00000095038] [ENSMUST00000102867] [ENSMUST00000107393] [ENSMUST00000119294]
AlphaFold Q80VW5
Predicted Effect probably benign
Transcript: ENSMUST00000063650
SMART Domains Protein: ENSMUSP00000069664
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 824 904 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063672
AA Change: H546R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065838
Gene: ENSMUSG00000039137
AA Change: H546R

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084510
SMART Domains Protein: ENSMUSP00000081557
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
PDZ 835 915 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095037
SMART Domains Protein: ENSMUSP00000092647
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
PDZ 321 401 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095038
SMART Domains Protein: ENSMUSP00000092648
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
PDZ 393 473 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102867
SMART Domains Protein: ENSMUSP00000099931
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 823 903 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107393
SMART Domains Protein: ENSMUSP00000103016
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 1.7e-23 SMART
PDZ 289 361 1.8e-21 SMART
low complexity region 526 545 N/A INTRINSIC
low complexity region 633 646 N/A INTRINSIC
PDZ 828 908 1.3e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119294
SMART Domains Protein: ENSMUSP00000114030
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
PDZ 382 462 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144965
SMART Domains Protein: ENSMUSP00000121944
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
PDB:1UF1|A 16 74 7e-33 PDB
SCOP:d1lcya1 32 74 1e-7 SMART
Blast:PDZ 40 74 5e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein required for elongation and actin polymerization in the hair cell stereocilia. The encoded protein is localized to the cytoplasm and co-localizes with the growing end of actin filaments. Mutations in this gene have been linked to deafness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Spontaneous mutants lacking both isoforms show short stereocilia, severe deafness and vestibular deficits. Targeted homozygotes lacking the long form show altered OHC stereocilia bundles but a milder phenotype with normal stereocilia in IHCs and a subset of vestibular HCs and no vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,471,735 (GRCm39) K1047E possibly damaging Het
Aadacl2fm1 A G 3: 59,839,110 (GRCm39) T11A possibly damaging Het
Abca14 A T 7: 119,807,191 (GRCm39) Y79F possibly damaging Het
Abca2 T A 2: 25,329,094 (GRCm39) M978K probably benign Het
Adamts3 A T 5: 89,848,269 (GRCm39) C684* probably null Het
Adnp2 T C 18: 80,172,637 (GRCm39) T591A probably benign Het
Aff4 A T 11: 53,263,306 (GRCm39) T109S probably damaging Het
Agmo A G 12: 37,293,720 (GRCm39) I48V probably benign Het
Appl1 G A 14: 26,649,784 (GRCm39) R581* probably null Het
Armc9 A T 1: 86,189,766 (GRCm39) M714L probably benign Het
Atp6v0d2 T A 4: 19,922,377 (GRCm39) T41S probably benign Het
Bin1 A T 18: 32,552,921 (GRCm39) Q182L probably damaging Het
Bmp10 A G 6: 87,410,684 (GRCm39) D159G probably benign Het
Bsn G A 9: 107,984,854 (GRCm39) P295S possibly damaging Het
Cbx6 A G 15: 79,712,606 (GRCm39) S274P probably damaging Het
Cdc20b A G 13: 113,192,631 (GRCm39) K108R probably benign Het
Ces1d T A 8: 93,912,724 (GRCm39) N238I probably damaging Het
Col7a1 C T 9: 108,787,708 (GRCm39) Q663* probably null Het
Cpsf3 T C 12: 21,358,039 (GRCm39) I517T possibly damaging Het
Cyp2a5 C A 7: 26,539,879 (GRCm39) T309N probably damaging Het
Cyp2d40 A G 15: 82,645,802 (GRCm39) F68L possibly damaging Het
Cyp7b1 A T 3: 18,150,837 (GRCm39) W301R probably damaging Het
Dnah6 T A 6: 73,189,513 (GRCm39) N45I probably benign Het
Dnah7a A T 1: 53,621,776 (GRCm39) H1116Q probably benign Het
Dntt A G 19: 41,027,356 (GRCm39) N141S probably benign Het
Fbxl13 T C 5: 21,790,201 (GRCm39) N281D probably damaging Het
Frem2 A T 3: 53,559,410 (GRCm39) L1699H probably damaging Het
Gabrr3 T C 16: 59,282,037 (GRCm39) V464A possibly damaging Het
Gdap1 T A 1: 17,227,353 (GRCm39) I160N probably damaging Het
Hnrnpll C A 17: 80,369,291 (GRCm39) R44L unknown Het
Hsp90ab1 T C 17: 45,881,680 (GRCm39) E187G probably damaging Het
Ighm T A 12: 113,386,210 (GRCm39) T47S Het
Itgb7 A C 15: 102,135,831 (GRCm39) probably null Het
Kif16b A T 2: 142,461,738 (GRCm39) C1293* probably null Het
Klf11 C T 12: 24,705,043 (GRCm39) R166C probably benign Het
Lca5l T A 16: 95,977,212 (GRCm39) Q198L probably damaging Het
Lnx2 A T 5: 146,961,180 (GRCm39) M584K probably benign Het
Lpp A T 16: 24,540,737 (GRCm39) M1L probably benign Het
Lrig3 A G 10: 125,832,953 (GRCm39) T276A probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Megf8 A T 7: 25,039,840 (GRCm39) probably null Het
Myh1 A C 11: 67,093,259 (GRCm39) T117P probably damaging Het
Neb C A 2: 52,134,113 (GRCm39) R3290L possibly damaging Het
Neb A C 2: 52,137,304 (GRCm39) V220G Het
Nktr A T 9: 121,577,264 (GRCm39) K444I probably damaging Het
Nol11 A T 11: 107,064,505 (GRCm39) M483K probably benign Het
Npy1r C A 8: 67,156,861 (GRCm39) P94T probably damaging Het
Nsmaf T C 4: 6,440,940 (GRCm39) T37A probably benign Het
Or10ad1b A G 15: 98,124,920 (GRCm39) L204P possibly damaging Het
Or2y3 G A 17: 38,393,056 (GRCm39) A271V possibly damaging Het
Or4c119 T C 2: 88,987,399 (GRCm39) N40S probably damaging Het
Or51v8 A T 7: 103,319,389 (GRCm39) M283K probably damaging Het
Or5w14 C A 2: 87,541,423 (GRCm39) V276F possibly damaging Het
Or8a1b A G 9: 37,623,473 (GRCm39) I34T probably damaging Het
Or8b37 G A 9: 37,958,775 (GRCm39) V86M possibly damaging Het
Palld C T 8: 61,969,691 (GRCm39) R1211H unknown Het
Pcdha3 A G 18: 37,080,284 (GRCm39) D342G probably damaging Het
Pclo G A 5: 14,815,877 (GRCm39) V1266I Het
Pcnx4 T C 12: 72,602,664 (GRCm39) Y309H probably damaging Het
Pde8a C T 7: 80,982,619 (GRCm39) T746I probably damaging Het
Pdzrn3 T G 6: 101,127,772 (GRCm39) K965Q probably damaging Het
Phldb1 G A 9: 44,615,425 (GRCm39) A225V probably benign Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plat A G 8: 23,265,599 (GRCm39) Y214C probably damaging Het
Plppr1 T A 4: 49,325,627 (GRCm39) C274* probably null Het
Poglut1 A G 16: 38,347,133 (GRCm39) F345L possibly damaging Het
Ppara A T 15: 85,661,837 (GRCm39) E26V possibly damaging Het
Ppcdc A T 9: 57,327,571 (GRCm39) W79R probably damaging Het
Prdm1 C T 10: 44,316,150 (GRCm39) C662Y probably damaging Het
Sgms2 G A 3: 131,136,011 (GRCm39) probably benign Het
Slc31a1 T A 4: 62,306,843 (GRCm39) M133K probably damaging Het
Smg1 G A 7: 117,777,998 (GRCm39) Q1309* probably null Het
Sos1 T C 17: 80,761,239 (GRCm39) I152M probably damaging Het
Stk4 A T 2: 163,952,136 (GRCm39) probably benign Het
Syne1 T G 10: 5,200,954 (GRCm39) N3538T probably damaging Het
Tbc1d16 A G 11: 119,099,666 (GRCm39) F236S probably damaging Het
Tgs1 T A 4: 3,595,475 (GRCm39) M548K probably benign Het
Twf1 G A 15: 94,483,336 (GRCm39) T124I probably damaging Het
Tyro3 G A 2: 119,642,648 (GRCm39) G611R probably damaging Het
Unc13b T A 4: 43,173,282 (GRCm39) I1370K unknown Het
Usp40 A G 1: 87,885,032 (GRCm39) W939R probably damaging Het
Vamp8 A T 6: 72,362,554 (GRCm39) V82E probably damaging Het
Vmn2r17 A G 5: 109,575,732 (GRCm39) H201R possibly damaging Het
Yeats2 T C 16: 20,033,228 (GRCm39) V1036A probably benign Het
Zfp352 T G 4: 90,112,575 (GRCm39) N238K probably benign Het
Zfp36l3 TCCAGGGGCGAGGGCAGCCCCAGGAGCAAGGGCCGCCCTAGGAATGAGGGCCGCCCCAGG TCCAGG X: 52,776,521 (GRCm39) probably benign Het
Zfp462 T A 4: 55,011,510 (GRCm39) S1159T probably benign Het
Zscan4-ps1 A T 7: 10,800,192 (GRCm39) H232Q probably benign Het
Other mutations in Whrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Whrn APN 4 63,391,015 (GRCm39) missense probably damaging 1.00
IGL01643:Whrn APN 4 63,334,672 (GRCm39) missense possibly damaging 0.79
IGL02065:Whrn APN 4 63,336,822 (GRCm39) missense possibly damaging 0.52
IGL02119:Whrn APN 4 63,353,724 (GRCm39) missense probably damaging 0.99
IGL02589:Whrn APN 4 63,336,334 (GRCm39) nonsense probably null
IGL02638:Whrn APN 4 63,337,709 (GRCm39) missense possibly damaging 0.47
IGL02865:Whrn APN 4 63,333,729 (GRCm39) missense probably benign 0.08
IGL02934:Whrn APN 4 63,334,342 (GRCm39) missense probably damaging 1.00
IGL03372:Whrn APN 4 63,336,855 (GRCm39) missense probably damaging 0.96
R0090:Whrn UTSW 4 63,350,969 (GRCm39) missense possibly damaging 0.79
R0592:Whrn UTSW 4 63,333,804 (GRCm39) missense probably damaging 1.00
R0631:Whrn UTSW 4 63,337,726 (GRCm39) missense probably damaging 1.00
R1916:Whrn UTSW 4 63,412,969 (GRCm39) missense probably damaging 1.00
R1933:Whrn UTSW 4 63,333,876 (GRCm39) nonsense probably null
R1958:Whrn UTSW 4 63,353,666 (GRCm39) missense possibly damaging 0.62
R2255:Whrn UTSW 4 63,336,385 (GRCm39) missense possibly damaging 0.92
R2513:Whrn UTSW 4 63,353,649 (GRCm39) missense probably benign 0.22
R3699:Whrn UTSW 4 63,379,649 (GRCm39) splice site probably benign
R3919:Whrn UTSW 4 63,413,421 (GRCm39) nonsense probably null
R4016:Whrn UTSW 4 63,333,876 (GRCm39) nonsense probably null
R4241:Whrn UTSW 4 63,351,210 (GRCm39) unclassified probably benign
R4517:Whrn UTSW 4 63,379,517 (GRCm39) critical splice donor site probably null
R4739:Whrn UTSW 4 63,336,402 (GRCm39) missense probably damaging 1.00
R5207:Whrn UTSW 4 63,350,951 (GRCm39) missense probably damaging 1.00
R5281:Whrn UTSW 4 63,336,664 (GRCm39) missense probably benign 0.04
R5307:Whrn UTSW 4 63,350,080 (GRCm39) missense probably benign 0.01
R5463:Whrn UTSW 4 63,351,053 (GRCm39) missense probably benign 0.08
R5663:Whrn UTSW 4 63,336,685 (GRCm39) missense probably damaging 0.98
R5754:Whrn UTSW 4 63,334,825 (GRCm39) missense probably damaging 0.98
R5933:Whrn UTSW 4 63,412,945 (GRCm39) missense probably damaging 1.00
R6212:Whrn UTSW 4 63,412,923 (GRCm39) nonsense probably null
R6380:Whrn UTSW 4 63,336,829 (GRCm39) missense possibly damaging 0.90
R6381:Whrn UTSW 4 63,390,921 (GRCm39) missense probably benign 0.00
R7030:Whrn UTSW 4 63,413,368 (GRCm39) unclassified probably benign
R7350:Whrn UTSW 4 63,350,196 (GRCm39) missense possibly damaging 0.71
R7382:Whrn UTSW 4 63,336,573 (GRCm39) missense probably benign
R7419:Whrn UTSW 4 63,334,330 (GRCm39) missense possibly damaging 0.94
R8334:Whrn UTSW 4 63,413,047 (GRCm39) missense probably damaging 1.00
X0009:Whrn UTSW 4 63,350,148 (GRCm39) missense probably benign 0.00
Z1176:Whrn UTSW 4 63,333,803 (GRCm39) missense probably damaging 1.00
Z1177:Whrn UTSW 4 63,336,736 (GRCm39) missense probably benign 0.00
Predicted Primers
Posted On 2022-04-18