Incidental Mutation 'R9378:Bmp10'
ID 709775
Institutional Source Beutler Lab
Gene Symbol Bmp10
Ensembl Gene ENSMUSG00000030046
Gene Name bone morphogenetic protein 10
Synonyms b2b2711Clo
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9378 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 87405976-87411494 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87410684 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 159 (D159G)
Ref Sequence ENSEMBL: ENSMUSP00000032125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032125]
AlphaFold Q9R229
Predicted Effect probably benign
Transcript: ENSMUST00000032125
AA Change: D159G

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032125
Gene: ENSMUSG00000030046
AA Change: D159G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TGFb_propeptide 52 256 8.1e-24 PFAM
TGFB 320 420 6.7e-52 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which binds to the activin receptor-like kinase 1 (ALK1) and plays important roles in cardiovascular development including cardiomyocyte proliferation and regulation of heart size, closure of the ductus arteriosus, angiogenesis and ventricular trabeculation. Homozygous knockout mice for this gene exhibit impaired heart development and embryonic lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice display decreased embryo size, cardiac dysgenesis, defects in early embryonic vascular development, enlarged pericardium, arteriovenous malformations, and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,471,735 (GRCm39) K1047E possibly damaging Het
Aadacl2fm1 A G 3: 59,839,110 (GRCm39) T11A possibly damaging Het
Abca14 A T 7: 119,807,191 (GRCm39) Y79F possibly damaging Het
Abca2 T A 2: 25,329,094 (GRCm39) M978K probably benign Het
Adamts3 A T 5: 89,848,269 (GRCm39) C684* probably null Het
Adnp2 T C 18: 80,172,637 (GRCm39) T591A probably benign Het
Aff4 A T 11: 53,263,306 (GRCm39) T109S probably damaging Het
Agmo A G 12: 37,293,720 (GRCm39) I48V probably benign Het
Appl1 G A 14: 26,649,784 (GRCm39) R581* probably null Het
Armc9 A T 1: 86,189,766 (GRCm39) M714L probably benign Het
Atp6v0d2 T A 4: 19,922,377 (GRCm39) T41S probably benign Het
Bin1 A T 18: 32,552,921 (GRCm39) Q182L probably damaging Het
Bsn G A 9: 107,984,854 (GRCm39) P295S possibly damaging Het
Cbx6 A G 15: 79,712,606 (GRCm39) S274P probably damaging Het
Cdc20b A G 13: 113,192,631 (GRCm39) K108R probably benign Het
Ces1d T A 8: 93,912,724 (GRCm39) N238I probably damaging Het
Col7a1 C T 9: 108,787,708 (GRCm39) Q663* probably null Het
Cpsf3 T C 12: 21,358,039 (GRCm39) I517T possibly damaging Het
Cyp2a5 C A 7: 26,539,879 (GRCm39) T309N probably damaging Het
Cyp2d40 A G 15: 82,645,802 (GRCm39) F68L possibly damaging Het
Cyp7b1 A T 3: 18,150,837 (GRCm39) W301R probably damaging Het
Dnah6 T A 6: 73,189,513 (GRCm39) N45I probably benign Het
Dnah7a A T 1: 53,621,776 (GRCm39) H1116Q probably benign Het
Dntt A G 19: 41,027,356 (GRCm39) N141S probably benign Het
Fbxl13 T C 5: 21,790,201 (GRCm39) N281D probably damaging Het
Frem2 A T 3: 53,559,410 (GRCm39) L1699H probably damaging Het
Gabrr3 T C 16: 59,282,037 (GRCm39) V464A possibly damaging Het
Gdap1 T A 1: 17,227,353 (GRCm39) I160N probably damaging Het
Hnrnpll C A 17: 80,369,291 (GRCm39) R44L unknown Het
Hsp90ab1 T C 17: 45,881,680 (GRCm39) E187G probably damaging Het
Ighm T A 12: 113,386,210 (GRCm39) T47S Het
Itgb7 A C 15: 102,135,831 (GRCm39) probably null Het
Kif16b A T 2: 142,461,738 (GRCm39) C1293* probably null Het
Klf11 C T 12: 24,705,043 (GRCm39) R166C probably benign Het
Lca5l T A 16: 95,977,212 (GRCm39) Q198L probably damaging Het
Lnx2 A T 5: 146,961,180 (GRCm39) M584K probably benign Het
Lpp A T 16: 24,540,737 (GRCm39) M1L probably benign Het
Lrig3 A G 10: 125,832,953 (GRCm39) T276A probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Megf8 A T 7: 25,039,840 (GRCm39) probably null Het
Myh1 A C 11: 67,093,259 (GRCm39) T117P probably damaging Het
Neb C A 2: 52,134,113 (GRCm39) R3290L possibly damaging Het
Neb A C 2: 52,137,304 (GRCm39) V220G Het
Nktr A T 9: 121,577,264 (GRCm39) K444I probably damaging Het
Nol11 A T 11: 107,064,505 (GRCm39) M483K probably benign Het
Npy1r C A 8: 67,156,861 (GRCm39) P94T probably damaging Het
Nsmaf T C 4: 6,440,940 (GRCm39) T37A probably benign Het
Or10ad1b A G 15: 98,124,920 (GRCm39) L204P possibly damaging Het
Or2y3 G A 17: 38,393,056 (GRCm39) A271V possibly damaging Het
Or4c119 T C 2: 88,987,399 (GRCm39) N40S probably damaging Het
Or51v8 A T 7: 103,319,389 (GRCm39) M283K probably damaging Het
Or5w14 C A 2: 87,541,423 (GRCm39) V276F possibly damaging Het
Or8a1b A G 9: 37,623,473 (GRCm39) I34T probably damaging Het
Or8b37 G A 9: 37,958,775 (GRCm39) V86M possibly damaging Het
Palld C T 8: 61,969,691 (GRCm39) R1211H unknown Het
Pcdha3 A G 18: 37,080,284 (GRCm39) D342G probably damaging Het
Pclo G A 5: 14,815,877 (GRCm39) V1266I Het
Pcnx4 T C 12: 72,602,664 (GRCm39) Y309H probably damaging Het
Pde8a C T 7: 80,982,619 (GRCm39) T746I probably damaging Het
Pdzrn3 T G 6: 101,127,772 (GRCm39) K965Q probably damaging Het
Phldb1 G A 9: 44,615,425 (GRCm39) A225V probably benign Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plat A G 8: 23,265,599 (GRCm39) Y214C probably damaging Het
Plppr1 T A 4: 49,325,627 (GRCm39) C274* probably null Het
Poglut1 A G 16: 38,347,133 (GRCm39) F345L possibly damaging Het
Ppara A T 15: 85,661,837 (GRCm39) E26V possibly damaging Het
Ppcdc A T 9: 57,327,571 (GRCm39) W79R probably damaging Het
Prdm1 C T 10: 44,316,150 (GRCm39) C662Y probably damaging Het
Sgms2 G A 3: 131,136,011 (GRCm39) probably benign Het
Slc31a1 T A 4: 62,306,843 (GRCm39) M133K probably damaging Het
Smg1 G A 7: 117,777,998 (GRCm39) Q1309* probably null Het
Sos1 T C 17: 80,761,239 (GRCm39) I152M probably damaging Het
Stk4 A T 2: 163,952,136 (GRCm39) probably benign Het
Syne1 T G 10: 5,200,954 (GRCm39) N3538T probably damaging Het
Tbc1d16 A G 11: 119,099,666 (GRCm39) F236S probably damaging Het
Tgs1 T A 4: 3,595,475 (GRCm39) M548K probably benign Het
Twf1 G A 15: 94,483,336 (GRCm39) T124I probably damaging Het
Tyro3 G A 2: 119,642,648 (GRCm39) G611R probably damaging Het
Unc13b T A 4: 43,173,282 (GRCm39) I1370K unknown Het
Usp40 A G 1: 87,885,032 (GRCm39) W939R probably damaging Het
Vamp8 A T 6: 72,362,554 (GRCm39) V82E probably damaging Het
Vmn2r17 A G 5: 109,575,732 (GRCm39) H201R possibly damaging Het
Whrn T C 4: 63,350,079 (GRCm39) H546R probably benign Het
Yeats2 T C 16: 20,033,228 (GRCm39) V1036A probably benign Het
Zfp352 T G 4: 90,112,575 (GRCm39) N238K probably benign Het
Zfp36l3 TCCAGGGGCGAGGGCAGCCCCAGGAGCAAGGGCCGCCCTAGGAATGAGGGCCGCCCCAGG TCCAGG X: 52,776,521 (GRCm39) probably benign Het
Zfp462 T A 4: 55,011,510 (GRCm39) S1159T probably benign Het
Zscan4-ps1 A T 7: 10,800,192 (GRCm39) H232Q probably benign Het
Other mutations in Bmp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Bmp10 APN 6 87,406,142 (GRCm39) missense possibly damaging 0.87
IGL00946:Bmp10 APN 6 87,411,344 (GRCm39) missense probably damaging 1.00
IGL01483:Bmp10 APN 6 87,410,933 (GRCm39) missense probably damaging 1.00
IGL02132:Bmp10 APN 6 87,411,130 (GRCm39) missense probably benign
R1391:Bmp10 UTSW 6 87,410,740 (GRCm39) missense probably benign 0.00
R1472:Bmp10 UTSW 6 87,410,779 (GRCm39) missense probably benign 0.34
R1938:Bmp10 UTSW 6 87,410,702 (GRCm39) missense possibly damaging 0.77
R2114:Bmp10 UTSW 6 87,411,441 (GRCm39) missense probably benign 0.10
R2158:Bmp10 UTSW 6 87,411,062 (GRCm39) missense probably benign 0.21
R4922:Bmp10 UTSW 6 87,410,557 (GRCm39) missense probably benign 0.00
R5042:Bmp10 UTSW 6 87,411,039 (GRCm39) missense probably damaging 0.98
R6041:Bmp10 UTSW 6 87,411,302 (GRCm39) missense probably damaging 1.00
R7000:Bmp10 UTSW 6 87,411,175 (GRCm39) missense probably benign 0.02
R7593:Bmp10 UTSW 6 87,410,651 (GRCm39) missense probably damaging 1.00
R8682:Bmp10 UTSW 6 87,410,541 (GRCm39) critical splice acceptor site probably null
R8844:Bmp10 UTSW 6 87,410,681 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATACTGCAAGTCTGGTTTC -3'
(R):5'- GGGCACTCATATCTATTTCCAGTTG -3'

Sequencing Primer
(F):5'- CTGCAAGTCTGGTTTCTCATAAG -3'
(R):5'- TCCGGTGTCCTCAGCTTGG -3'
Posted On 2022-04-18