Incidental Mutation 'R9378:Ppcdc'
ID 709791
Institutional Source Beutler Lab
Gene Symbol Ppcdc
Ensembl Gene ENSMUSG00000063849
Gene Name phosphopantothenoylcysteine decarboxylase
Synonyms 1810057I13Rik, 8430432M10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock # R9378 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 57385095-57440124 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57420288 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 79 (W79R)
Ref Sequence ENSEMBL: ENSMUSP00000082856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085709] [ENSMUST00000213194] [ENSMUST00000213479] [ENSMUST00000214065] [ENSMUST00000214144] [ENSMUST00000214166] [ENSMUST00000214339] [ENSMUST00000214624] [ENSMUST00000215299] [ENSMUST00000215883] [ENSMUST00000216365]
AlphaFold Q8BZB2
Predicted Effect probably damaging
Transcript: ENSMUST00000085709
AA Change: W79R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082856
Gene: ENSMUSG00000063849
AA Change: W79R

DomainStartEndE-ValueType
Pfam:Flavoprotein 18 149 7.9e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213194
Predicted Effect possibly damaging
Transcript: ENSMUST00000213479
AA Change: W2R

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000214065
AA Change: W79R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214144
AA Change: W79R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000214166
Predicted Effect probably benign
Transcript: ENSMUST00000214339
Predicted Effect probably benign
Transcript: ENSMUST00000214624
Predicted Effect probably damaging
Transcript: ENSMUST00000215299
AA Change: W47R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215883
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000216365
AA Change: W79R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCDC (EC 4.1.1.36), one of the last enzymes in this pathway, converts phosphopantothenoylcysteine to 4-prime-phosphopantetheine (Daugherty et al., 2002 [PubMed 11923312]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2210408I21Rik A G 13: 77,323,616 K1047E possibly damaging Het
Abca14 A T 7: 120,207,968 Y79F possibly damaging Het
Abca2 T A 2: 25,439,082 M978K probably benign Het
Adamts3 A T 5: 89,700,410 C684* probably null Het
Adnp2 T C 18: 80,129,422 T591A probably benign Het
Aff4 A T 11: 53,372,479 T109S probably damaging Het
Agmo A G 12: 37,243,721 I48V probably benign Het
Appl1 G A 14: 26,927,827 R581* probably null Het
Armc9 A T 1: 86,262,044 M714L probably benign Het
Atp6v0d2 T A 4: 19,922,377 T41S probably benign Het
Bin1 A T 18: 32,419,868 Q182L probably damaging Het
Bmp10 A G 6: 87,433,702 D159G probably benign Het
Bsn G A 9: 108,107,655 P295S possibly damaging Het
C130079G13Rik A G 3: 59,931,689 T11A possibly damaging Het
Cbx6 A G 15: 79,828,405 S274P probably damaging Het
Cdc20b A G 13: 113,056,097 K108R probably benign Het
Ces1d T A 8: 93,186,096 N238I probably damaging Het
Col7a1 C T 9: 108,958,640 Q663* probably null Het
Cpsf3 T C 12: 21,308,038 I517T possibly damaging Het
Cyp2a5 C A 7: 26,840,454 T309N probably damaging Het
Cyp2d40 A G 15: 82,761,601 F68L possibly damaging Het
Cyp7b1 A T 3: 18,096,673 W301R probably damaging Het
Dnah6 T A 6: 73,212,530 N45I probably benign Het
Dnah7a A T 1: 53,582,617 H1116Q probably benign Het
Dntt A G 19: 41,038,917 N141S probably benign Het
Fbxl13 T C 5: 21,585,203 N281D probably damaging Het
Frem2 A T 3: 53,651,989 L1699H probably damaging Het
Gabrr3 T C 16: 59,461,674 V464A possibly damaging Het
Gdap1 T A 1: 17,157,129 I160N probably damaging Het
Hnrnpll C A 17: 80,061,862 R44L unknown Het
Hsp90ab1 T C 17: 45,570,754 E187G probably damaging Het
Ighm T A 12: 113,422,590 T47S Het
Itgb7 A C 15: 102,227,396 probably null Het
Kif16b A T 2: 142,619,818 C1293* probably null Het
Klf11 C T 12: 24,655,044 R166C probably benign Het
Lca5l T A 16: 96,176,012 Q198L probably damaging Het
Lnx2 A T 5: 147,024,370 M584K probably benign Het
Lpp A T 16: 24,721,987 M1L probably benign Het
Lrig3 A G 10: 125,997,084 T276A probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Megf8 A T 7: 25,340,415 probably null Het
Myh1 A C 11: 67,202,433 T117P probably damaging Het
Neb C A 2: 52,244,101 R3290L possibly damaging Het
Neb A C 2: 52,247,292 V220G Het
Nktr A T 9: 121,748,198 K444I probably damaging Het
Nol11 A T 11: 107,173,679 M483K probably benign Het
Npy1r C A 8: 66,704,209 P94T probably damaging Het
Nsmaf T C 4: 6,440,940 T37A probably benign Het
Olfr1137 C A 2: 87,711,079 V276F possibly damaging Het
Olfr1224-ps1 T C 2: 89,157,055 N40S probably damaging Het
Olfr131 G A 17: 38,082,165 A271V possibly damaging Het
Olfr160 A G 9: 37,712,177 I34T probably damaging Het
Olfr286 A G 15: 98,227,039 L204P possibly damaging Het
Olfr624 A T 7: 103,670,182 M283K probably damaging Het
Olfr884 G A 9: 38,047,479 V86M possibly damaging Het
Palld C T 8: 61,516,657 R1211H unknown Het
Pcdha3 A G 18: 36,947,231 D342G probably damaging Het
Pclo G A 5: 14,765,863 V1266I Het
Pcnx4 T C 12: 72,555,890 Y309H probably damaging Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Pdzrn3 T G 6: 101,150,811 K965Q probably damaging Het
Phldb1 G A 9: 44,704,128 A225V probably benign Het
Plat A G 8: 22,775,583 Y214C probably damaging Het
Plppr1 T A 4: 49,325,627 C274* probably null Het
Poglut1 A G 16: 38,526,771 F345L possibly damaging Het
Ppara A T 15: 85,777,636 E26V possibly damaging Het
Prdm1 C T 10: 44,440,154 C662Y probably damaging Het
Sgms2 G A 3: 131,342,362 probably benign Het
Slc31a1 T A 4: 62,388,606 M133K probably damaging Het
Smg1 G A 7: 118,178,775 Q1309* probably null Het
Sos1 T C 17: 80,453,810 I152M probably damaging Het
Stk4 A T 2: 164,110,216 probably benign Het
Syne1 T G 10: 5,250,954 N3538T probably damaging Het
Tbc1d16 A G 11: 119,208,840 F236S probably damaging Het
Tgs1 T A 4: 3,595,475 M548K probably benign Het
Twf1 G A 15: 94,585,455 T124I probably damaging Het
Tyro3 G A 2: 119,812,167 G611R probably damaging Het
Unc13b T A 4: 43,173,282 I1370K unknown Het
Usp40 A G 1: 87,957,310 W939R probably damaging Het
Vamp8 A T 6: 72,385,571 V82E probably damaging Het
Vmn2r17 A G 5: 109,427,866 H201R possibly damaging Het
Whrn T C 4: 63,431,842 H546R probably benign Het
Yeats2 T C 16: 20,214,478 V1036A probably benign Het
Zfp352 T G 4: 90,224,338 N238K probably benign Het
Zfp36l3 TCCAGGGGCGAGGGCAGCCCCAGGAGCAAGGGCCGCCCTAGGAATGAGGGCCGCCCCAGG TCCAGG X: 53,774,554 probably benign Het
Zfp462 T A 4: 55,011,510 S1159T probably benign Het
Zscan4-ps1 A T 7: 11,066,265 H232Q probably benign Het
Other mutations in Ppcdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Ppcdc APN 9 57415140 missense probably benign 0.00
R0945:Ppcdc UTSW 9 57420158 splice site probably null
R1666:Ppcdc UTSW 9 57414715 missense possibly damaging 0.91
R3684:Ppcdc UTSW 9 57421125 critical splice donor site probably null
R4223:Ppcdc UTSW 9 57414715 missense possibly damaging 0.91
R4821:Ppcdc UTSW 9 57434911 missense probably benign 0.00
R5121:Ppcdc UTSW 9 57421163 missense possibly damaging 0.56
R5236:Ppcdc UTSW 9 57414654 missense probably benign 0.00
R7034:Ppcdc UTSW 9 57415170 missense probably damaging 1.00
R7303:Ppcdc UTSW 9 57414675 missense probably benign
R7591:Ppcdc UTSW 9 57434979 missense probably damaging 1.00
R7835:Ppcdc UTSW 9 57420276 missense probably benign 0.02
R8942:Ppcdc UTSW 9 57434982 missense probably benign 0.00
R8944:Ppcdc UTSW 9 57434982 missense probably benign 0.00
R9324:Ppcdc UTSW 9 57434997 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGCAGACTGGGAACAAG -3'
(R):5'- AAACATTTCTGGCTGGGCTG -3'

Sequencing Primer
(F):5'- CAAGGCTGGAGAGAACAGACACC -3'
(R):5'- AGAGTTCTTCTACTGGCTTGGACAAC -3'
Posted On 2022-04-18