Incidental Mutation 'R9378:Syne1'
ID 709795
Institutional Source Beutler Lab
Gene Symbol Syne1
Ensembl Gene ENSMUSG00000096054
Gene Name spectrin repeat containing, nuclear envelope 1
Synonyms A330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9378 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 5020917-5551482 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 5250954 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 3538 (N3538T)
Ref Sequence ENSEMBL: ENSMUSP00000150262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215295]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000215295
AA Change: N3538T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2210408I21Rik A G 13: 77,323,616 K1047E possibly damaging Het
Abca14 A T 7: 120,207,968 Y79F possibly damaging Het
Abca2 T A 2: 25,439,082 M978K probably benign Het
Adamts3 A T 5: 89,700,410 C684* probably null Het
Adnp2 T C 18: 80,129,422 T591A probably benign Het
Aff4 A T 11: 53,372,479 T109S probably damaging Het
Agmo A G 12: 37,243,721 I48V probably benign Het
Appl1 G A 14: 26,927,827 R581* probably null Het
Armc9 A T 1: 86,262,044 M714L probably benign Het
Atp6v0d2 T A 4: 19,922,377 T41S probably benign Het
Bin1 A T 18: 32,419,868 Q182L probably damaging Het
Bmp10 A G 6: 87,433,702 D159G probably benign Het
Bsn G A 9: 108,107,655 P295S possibly damaging Het
C130079G13Rik A G 3: 59,931,689 T11A possibly damaging Het
Cbx6 A G 15: 79,828,405 S274P probably damaging Het
Cdc20b A G 13: 113,056,097 K108R probably benign Het
Ces1d T A 8: 93,186,096 N238I probably damaging Het
Col7a1 C T 9: 108,958,640 Q663* probably null Het
Cpsf3 T C 12: 21,308,038 I517T possibly damaging Het
Cyp2a5 C A 7: 26,840,454 T309N probably damaging Het
Cyp2d40 A G 15: 82,761,601 F68L possibly damaging Het
Cyp7b1 A T 3: 18,096,673 W301R probably damaging Het
Dnah6 T A 6: 73,212,530 N45I probably benign Het
Dnah7a A T 1: 53,582,617 H1116Q probably benign Het
Dntt A G 19: 41,038,917 N141S probably benign Het
Fbxl13 T C 5: 21,585,203 N281D probably damaging Het
Frem2 A T 3: 53,651,989 L1699H probably damaging Het
Gabrr3 T C 16: 59,461,674 V464A possibly damaging Het
Gdap1 T A 1: 17,157,129 I160N probably damaging Het
Hnrnpll C A 17: 80,061,862 R44L unknown Het
Hsp90ab1 T C 17: 45,570,754 E187G probably damaging Het
Ighm T A 12: 113,422,590 T47S Het
Itgb7 A C 15: 102,227,396 probably null Het
Kif16b A T 2: 142,619,818 C1293* probably null Het
Klf11 C T 12: 24,655,044 R166C probably benign Het
Lca5l T A 16: 96,176,012 Q198L probably damaging Het
Lnx2 A T 5: 147,024,370 M584K probably benign Het
Lpp A T 16: 24,721,987 M1L probably benign Het
Lrig3 A G 10: 125,997,084 T276A probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Megf8 A T 7: 25,340,415 probably null Het
Myh1 A C 11: 67,202,433 T117P probably damaging Het
Neb C A 2: 52,244,101 R3290L possibly damaging Het
Neb A C 2: 52,247,292 V220G Het
Nktr A T 9: 121,748,198 K444I probably damaging Het
Nol11 A T 11: 107,173,679 M483K probably benign Het
Npy1r C A 8: 66,704,209 P94T probably damaging Het
Nsmaf T C 4: 6,440,940 T37A probably benign Het
Olfr1137 C A 2: 87,711,079 V276F possibly damaging Het
Olfr1224-ps1 T C 2: 89,157,055 N40S probably damaging Het
Olfr131 G A 17: 38,082,165 A271V possibly damaging Het
Olfr160 A G 9: 37,712,177 I34T probably damaging Het
Olfr286 A G 15: 98,227,039 L204P possibly damaging Het
Olfr624 A T 7: 103,670,182 M283K probably damaging Het
Olfr884 G A 9: 38,047,479 V86M possibly damaging Het
Palld C T 8: 61,516,657 R1211H unknown Het
Pcdha3 A G 18: 36,947,231 D342G probably damaging Het
Pclo G A 5: 14,765,863 V1266I Het
Pcnx4 T C 12: 72,555,890 Y309H probably damaging Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Pdzrn3 T G 6: 101,150,811 K965Q probably damaging Het
Phldb1 G A 9: 44,704,128 A225V probably benign Het
Plat A G 8: 22,775,583 Y214C probably damaging Het
Plppr1 T A 4: 49,325,627 C274* probably null Het
Poglut1 A G 16: 38,526,771 F345L possibly damaging Het
Ppara A T 15: 85,777,636 E26V possibly damaging Het
Ppcdc A T 9: 57,420,288 W79R probably damaging Het
Prdm1 C T 10: 44,440,154 C662Y probably damaging Het
Sgms2 G A 3: 131,342,362 probably benign Het
Slc31a1 T A 4: 62,388,606 M133K probably damaging Het
Smg1 G A 7: 118,178,775 Q1309* probably null Het
Sos1 T C 17: 80,453,810 I152M probably damaging Het
Stk4 A T 2: 164,110,216 probably benign Het
Tbc1d16 A G 11: 119,208,840 F236S probably damaging Het
Tgs1 T A 4: 3,595,475 M548K probably benign Het
Twf1 G A 15: 94,585,455 T124I probably damaging Het
Tyro3 G A 2: 119,812,167 G611R probably damaging Het
Unc13b T A 4: 43,173,282 I1370K unknown Het
Usp40 A G 1: 87,957,310 W939R probably damaging Het
Vamp8 A T 6: 72,385,571 V82E probably damaging Het
Vmn2r17 A G 5: 109,427,866 H201R possibly damaging Het
Whrn T C 4: 63,431,842 H546R probably benign Het
Yeats2 T C 16: 20,214,478 V1036A probably benign Het
Zfp352 T G 4: 90,224,338 N238K probably benign Het
Zfp36l3 TCCAGGGGCGAGGGCAGCCCCAGGAGCAAGGGCCGCCCTAGGAATGAGGGCCGCCCCAGG TCCAGG X: 53,774,554 probably benign Het
Zfp462 T A 4: 55,011,510 S1159T probably benign Het
Zscan4-ps1 A T 7: 11,066,265 H232Q probably benign Het
Other mutations in Syne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Syne1 APN 10 5342167 synonymous probably benign
IGL00725:Syne1 APN 10 5344922 missense possibly damaging 0.48
IGL00799:Syne1 APN 10 5347878 missense probably benign 0.00
IGL01087:Syne1 APN 10 5425708 missense probably damaging 1.00
IGL01123:Syne1 APN 10 5344921 nonsense probably null
IGL01147:Syne1 APN 10 5052691 nonsense probably null
IGL01150:Syne1 APN 10 5443154 missense probably damaging 1.00
IGL01154:Syne1 APN 10 5360848 missense probably damaging 1.00
IGL01727:Syne1 APN 10 5047842 missense probably damaging 0.99
IGL01761:Syne1 APN 10 5405456 missense probably damaging 1.00
IGL01793:Syne1 APN 10 5352191 missense possibly damaging 0.67
IGL01961:Syne1 APN 10 5043723 missense possibly damaging 0.94
IGL01975:Syne1 APN 10 5068908 intron probably benign
IGL02152:Syne1 APN 10 5424382 missense probably damaging 1.00
IGL02423:Syne1 APN 10 5368295 missense probably benign 0.00
IGL02457:Syne1 APN 10 5342167 missense probably damaging 1.00
IGL02543:Syne1 APN 10 5043618 missense probably damaging 0.97
IGL02836:Syne1 APN 10 5409875 splice site probably benign
IGL03141:Syne1 APN 10 5424261 missense probably damaging 1.00
FR4548:Syne1 UTSW 10 5032969 missense probably benign 0.09
IGL02799:Syne1 UTSW 10 5359059 missense probably damaging 1.00
PIT4305001:Syne1 UTSW 10 5333023 missense probably damaging 1.00
PIT4687001:Syne1 UTSW 10 5358390 missense possibly damaging 0.87
R0004:Syne1 UTSW 10 5443132 splice site probably benign
R0110:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0165:Syne1 UTSW 10 5033096 missense probably benign 0.28
R0194:Syne1 UTSW 10 5424311 missense probably benign
R0311:Syne1 UTSW 10 5348943 missense possibly damaging 0.92
R0328:Syne1 UTSW 10 5348945 missense possibly damaging 0.62
R0379:Syne1 UTSW 10 5541989 missense probably damaging 1.00
R0387:Syne1 UTSW 10 5351029 missense probably benign
R0452:Syne1 UTSW 10 5405435 missense probably damaging 0.98
R0456:Syne1 UTSW 10 5342252 missense probably benign 0.04
R0457:Syne1 UTSW 10 5022041 missense probably damaging 1.00
R0469:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0510:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0533:Syne1 UTSW 10 5358438 missense probably benign 0.00
R0617:Syne1 UTSW 10 5350933 missense probably damaging 1.00
R0690:Syne1 UTSW 10 5033138 splice site probably benign
R0964:Syne1 UTSW 10 5043652 missense possibly damaging 0.95
R1133:Syne1 UTSW 10 5349044 missense possibly damaging 0.77
R1327:Syne1 UTSW 10 5048925 splice site probably benign
R1339:Syne1 UTSW 10 5367571 missense probably damaging 1.00
R1531:Syne1 UTSW 10 5347875 nonsense probably null
R1558:Syne1 UTSW 10 5349280 nonsense probably null
R1633:Syne1 UTSW 10 5349388 missense probably damaging 1.00
R1642:Syne1 UTSW 10 5348694 missense possibly damaging 0.94
R1658:Syne1 UTSW 10 5367616 missense probably benign 0.03
R1753:Syne1 UTSW 10 5367621 missense probably benign 0.28
R1759:Syne1 UTSW 10 5349369 missense probably damaging 1.00
R1792:Syne1 UTSW 10 5040975 missense probably damaging 1.00
R2076:Syne1 UTSW 10 5040897 missense probably damaging 0.99
R2079:Syne1 UTSW 10 5361502 missense probably benign 0.01
R2102:Syne1 UTSW 10 5056514 missense probably damaging 1.00
R2233:Syne1 UTSW 10 5041484 missense probably benign 0.01
R2305:Syne1 UTSW 10 5047573 missense probably damaging 0.97
R3435:Syne1 UTSW 10 5348565 missense probably damaging 1.00
R3749:Syne1 UTSW 10 5052267 splice site probably benign
R3876:Syne1 UTSW 10 5052345 missense possibly damaging 0.57
R3895:Syne1 UTSW 10 5405456 missense probably damaging 0.98
R3974:Syne1 UTSW 10 5043630 missense probably benign 0.06
R4042:Syne1 UTSW 10 5041584 missense probably benign 0.21
R4120:Syne1 UTSW 10 5409798 missense probably damaging 1.00
R4201:Syne1 UTSW 10 5347870 missense probably benign
R4364:Syne1 UTSW 10 5353987 missense probably damaging 0.96
R4498:Syne1 UTSW 10 5031768 missense probably benign 0.00
R4767:Syne1 UTSW 10 5344866 nonsense probably null
R4804:Syne1 UTSW 10 5349310 missense possibly damaging 0.95
R4917:Syne1 UTSW 10 5057909 missense probably damaging 1.00
R4930:Syne1 UTSW 10 5052777 missense probably damaging 0.99
R5081:Syne1 UTSW 10 5047767 missense probably benign 0.04
R5089:Syne1 UTSW 10 5405444 nonsense probably null
R5174:Syne1 UTSW 10 5041490 missense probably damaging 0.99
R5205:Syne1 UTSW 10 5052295 missense probably benign 0.05
R5303:Syne1 UTSW 10 5420464 missense probably benign 0.00
R5384:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5385:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5392:Syne1 UTSW 10 5348661 missense probably damaging 1.00
R5442:Syne1 UTSW 10 5343473 missense probably benign 0.09
R5750:Syne1 UTSW 10 5339209 missense probably benign 0.01
R5935:Syne1 UTSW 10 5360706 splice site probably null
R6015:Syne1 UTSW 10 5346819 critical splice donor site probably null
R6023:Syne1 UTSW 10 5443223 missense probably benign 0.09
R6049:Syne1 UTSW 10 5347926 missense possibly damaging 0.79
R6084:Syne1 UTSW 10 5348994 missense probably damaging 1.00
R6145:Syne1 UTSW 10 5052750 missense probably damaging 1.00
R6164:Syne1 UTSW 10 5061429 missense probably damaging 1.00
R6165:Syne1 UTSW 10 5425678 missense probably damaging 1.00
R6198:Syne1 UTSW 10 5302269 missense probably damaging 0.99
R6217:Syne1 UTSW 10 5293761 missense probably benign 0.00
R6247:Syne1 UTSW 10 5349071 missense probably damaging 0.98
R6271:Syne1 UTSW 10 5234652 missense probably damaging 1.00
R6338:Syne1 UTSW 10 5255475 missense probably benign 0.00
R6344:Syne1 UTSW 10 5022212 missense probably benign 0.08
R6434:Syne1 UTSW 10 5318422 missense probably benign 0.01
R6476:Syne1 UTSW 10 5154531 missense possibly damaging 0.88
R6479:Syne1 UTSW 10 5231679 nonsense probably null
R6479:Syne1 UTSW 10 5456826 missense probably damaging 1.00
R6546:Syne1 UTSW 10 5218645 nonsense probably null
R6578:Syne1 UTSW 10 5405454 nonsense probably null
R6611:Syne1 UTSW 10 5045273 missense probably benign 0.01
R6615:Syne1 UTSW 10 5301340 missense probably damaging 0.98
R6632:Syne1 UTSW 10 5215667 critical splice donor site probably null
R6662:Syne1 UTSW 10 5128416 missense probably damaging 1.00
R6677:Syne1 UTSW 10 5040942 missense possibly damaging 0.82
R6764:Syne1 UTSW 10 5229011 nonsense probably null
R6765:Syne1 UTSW 10 5143285 splice site probably null
R6778:Syne1 UTSW 10 5102406 missense probably damaging 0.97
R6851:Syne1 UTSW 10 5262703 nonsense probably null
R6878:Syne1 UTSW 10 5420388 missense possibly damaging 0.78
R6883:Syne1 UTSW 10 5231704 nonsense probably null
R6910:Syne1 UTSW 10 5048887 missense probably benign 0.01
R6916:Syne1 UTSW 10 5227912 missense probably benign 0.00
R6925:Syne1 UTSW 10 5126682 missense probably benign 0.00
R6943:Syne1 UTSW 10 5083940 missense probably benign
R6947:Syne1 UTSW 10 5175789 missense probably damaging 1.00
R6965:Syne1 UTSW 10 5229120 missense possibly damaging 0.66
R6968:Syne1 UTSW 10 5117041 missense probably benign 0.09
R7043:Syne1 UTSW 10 5072193 missense possibly damaging 0.77
R7059:Syne1 UTSW 10 5346859 missense probably damaging 1.00
R7067:Syne1 UTSW 10 5234586 missense probably damaging 1.00
R7087:Syne1 UTSW 10 5542024 start gained probably benign
R7099:Syne1 UTSW 10 5123744 missense probably benign 0.43
R7107:Syne1 UTSW 10 5132078 missense probably damaging 1.00
R7120:Syne1 UTSW 10 5293971 missense probably benign
R7127:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7128:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7131:Syne1 UTSW 10 5228221 missense probably damaging 1.00
R7132:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7133:Syne1 UTSW 10 5231592 missense probably damaging 1.00
R7135:Syne1 UTSW 10 5233409 missense probably benign 0.01
R7147:Syne1 UTSW 10 5249340 missense probably damaging 1.00
R7158:Syne1 UTSW 10 5057931 missense probably damaging 1.00
R7189:Syne1 UTSW 10 5424295 missense probably benign 0.03
R7193:Syne1 UTSW 10 5233406 missense probably damaging 1.00
R7194:Syne1 UTSW 10 5110859 missense probably damaging 1.00
R7233:Syne1 UTSW 10 5302160 missense probably damaging 1.00
R7255:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7267:Syne1 UTSW 10 5228218 missense probably damaging 1.00
R7294:Syne1 UTSW 10 5097483 critical splice donor site probably null
R7303:Syne1 UTSW 10 5256805 missense probably benign 0.04
R7313:Syne1 UTSW 10 5047635 missense probably damaging 1.00
R7330:Syne1 UTSW 10 5128434 missense probably benign 0.00
R7334:Syne1 UTSW 10 5057886 missense probably damaging 1.00
R7363:Syne1 UTSW 10 5140970 missense possibly damaging 0.45
R7400:Syne1 UTSW 10 5218580 missense probably benign 0.12
R7425:Syne1 UTSW 10 5425760 missense probably damaging 1.00
R7427:Syne1 UTSW 10 5273718 missense probably damaging 0.98
R7446:Syne1 UTSW 10 5222266 missense probably benign 0.00
R7462:Syne1 UTSW 10 5052793 missense possibly damaging 0.87
R7502:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7525:Syne1 UTSW 10 5185559 critical splice acceptor site probably null
R7529:Syne1 UTSW 10 5424382 missense probably damaging 1.00
R7577:Syne1 UTSW 10 5124820 missense probably damaging 1.00
R7579:Syne1 UTSW 10 5349324 missense probably damaging 1.00
R7594:Syne1 UTSW 10 5215190 critical splice donor site probably null
R7646:Syne1 UTSW 10 5172949 missense probably damaging 1.00
R7651:Syne1 UTSW 10 5205074 missense probably benign 0.38
R7651:Syne1 UTSW 10 5343416 missense probably damaging 1.00
R7669:Syne1 UTSW 10 5061531 missense probably damaging 1.00
R7672:Syne1 UTSW 10 5218527 missense probably benign 0.02
R7682:Syne1 UTSW 10 5162461 missense probably benign
R7702:Syne1 UTSW 10 5245835 missense probably damaging 1.00
R7767:Syne1 UTSW 10 5333560 missense possibly damaging 0.60
R7767:Syne1 UTSW 10 5333632 missense possibly damaging 0.49
R7829:Syne1 UTSW 10 5342293 missense probably damaging 0.96
R7840:Syne1 UTSW 10 5132078 missense probably damaging 1.00
R7859:Syne1 UTSW 10 5157683 missense possibly damaging 0.80
R7899:Syne1 UTSW 10 5227956 nonsense probably null
R7918:Syne1 UTSW 10 5359078 missense possibly damaging 0.50
R7923:Syne1 UTSW 10 5264738 missense probably damaging 1.00
R7946:Syne1 UTSW 10 5250919 missense possibly damaging 0.92
R7966:Syne1 UTSW 10 5116965 critical splice donor site probably null
R7975:Syne1 UTSW 10 5031786 missense probably benign 0.00
R7981:Syne1 UTSW 10 5229248 missense probably benign 0.04
R8053:Syne1 UTSW 10 5052658 nonsense probably null
R8054:Syne1 UTSW 10 5270970 missense probably benign 0.22
R8062:Syne1 UTSW 10 5185394 critical splice donor site probably null
R8085:Syne1 UTSW 10 5228021 missense possibly damaging 0.78
R8087:Syne1 UTSW 10 5333034 missense probably benign
R8094:Syne1 UTSW 10 5117031 missense probably damaging 0.98
R8310:Syne1 UTSW 10 5347829 missense probably benign
R8325:Syne1 UTSW 10 5146257 missense probably benign 0.15
R8342:Syne1 UTSW 10 5108622 missense probably benign 0.18
R8353:Syne1 UTSW 10 5350983 missense probably damaging 1.00
R8376:Syne1 UTSW 10 5043615 missense probably benign 0.09
R8398:Syne1 UTSW 10 5124923 missense probably damaging 1.00
R8434:Syne1 UTSW 10 5123057 missense probably benign 0.00
R8436:Syne1 UTSW 10 5228659 missense probably benign 0.26
R8459:Syne1 UTSW 10 5424277 nonsense probably null
R8461:Syne1 UTSW 10 5061463 missense probably benign 0.34
R8496:Syne1 UTSW 10 5228896 missense probably damaging 0.99
R8496:Syne1 UTSW 10 5318441 missense probably damaging 0.99
R8693:Syne1 UTSW 10 5140928 missense possibly damaging 0.60
R8698:Syne1 UTSW 10 5229229 missense probably damaging 1.00
R8701:Syne1 UTSW 10 5205026 nonsense probably null
R8713:Syne1 UTSW 10 5316040 missense probably damaging 1.00
R8724:Syne1 UTSW 10 5083861 missense possibly damaging 0.77
R8729:Syne1 UTSW 10 5229275 missense probably benign 0.00
R8742:Syne1 UTSW 10 5108661 missense probably benign 0.09
R8757:Syne1 UTSW 10 5194618 missense probably damaging 1.00
R8776:Syne1 UTSW 10 5231783 missense possibly damaging 0.81
R8776-TAIL:Syne1 UTSW 10 5231783 missense possibly damaging 0.81
R8778:Syne1 UTSW 10 5359066 missense probably benign 0.00
R8801:Syne1 UTSW 10 5358335 missense probably damaging 1.00
R8803:Syne1 UTSW 10 5361535 missense probably damaging 1.00
R8808:Syne1 UTSW 10 5359074 missense probably damaging 1.00
R8829:Syne1 UTSW 10 5108685 missense probably benign
R8843:Syne1 UTSW 10 5193040 missense possibly damaging 0.88
R8843:Syne1 UTSW 10 5330204 missense probably benign 0.01
R8854:Syne1 UTSW 10 5128503 missense probably benign 0.00
R8863:Syne1 UTSW 10 5099527 missense probably damaging 1.00
R8864:Syne1 UTSW 10 5420473 missense probably benign 0.01
R8881:Syne1 UTSW 10 5273639 missense probably damaging 1.00
R8884:Syne1 UTSW 10 5231822 missense possibly damaging 0.93
R8893:Syne1 UTSW 10 5349020 nonsense probably null
R8958:Syne1 UTSW 10 5231768 missense probably benign
R8964:Syne1 UTSW 10 5110872 missense
R8975:Syne1 UTSW 10 5211945 missense probably benign 0.04
R8987:Syne1 UTSW 10 5227579 missense possibly damaging 0.92
R8992:Syne1 UTSW 10 5185508 missense probably benign 0.01
R9005:Syne1 UTSW 10 5205406 missense probably benign
R9084:Syne1 UTSW 10 5339240 missense probably benign 0.01
R9117:Syne1 UTSW 10 5103667 missense probably damaging 0.96
R9128:Syne1 UTSW 10 5108556 missense probably benign 0.38
R9181:Syne1 UTSW 10 5113994 missense probably damaging 0.99
R9189:Syne1 UTSW 10 5173008 missense probably damaging 1.00
R9189:Syne1 UTSW 10 5222289 missense probably benign 0.00
R9205:Syne1 UTSW 10 5202013 nonsense probably null
R9217:Syne1 UTSW 10 5349324 missense probably damaging 1.00
R9246:Syne1 UTSW 10 5305706 missense probably benign 0.00
R9264:Syne1 UTSW 10 5262793 missense probably damaging 1.00
R9273:Syne1 UTSW 10 5040901 missense probably benign 0.16
R9315:Syne1 UTSW 10 5333553 missense possibly damaging 0.79
R9331:Syne1 UTSW 10 5123666 missense probably benign 0.45
R9355:Syne1 UTSW 10 5368255 missense probably damaging 1.00
R9389:Syne1 UTSW 10 5229193 missense possibly damaging 0.65
R9395:Syne1 UTSW 10 5311728 missense probably damaging 1.00
R9405:Syne1 UTSW 10 5202030 missense probably damaging 1.00
R9417:Syne1 UTSW 10 5132021 missense probably benign
R9419:Syne1 UTSW 10 5205071 missense probably benign 0.01
R9473:Syne1 UTSW 10 5248258 missense probably benign 0.00
R9484:Syne1 UTSW 10 5220359 missense probably damaging 1.00
R9505:Syne1 UTSW 10 5030394 missense probably benign 0.00
R9509:Syne1 UTSW 10 5348927 critical splice donor site probably null
R9546:Syne1 UTSW 10 5243123 missense probably damaging 1.00
R9567:Syne1 UTSW 10 5246386 missense possibly damaging 0.54
R9601:Syne1 UTSW 10 5259270 missense probably benign 0.23
R9619:Syne1 UTSW 10 5140909 missense probably benign 0.03
R9621:Syne1 UTSW 10 5323887 missense probably benign 0.01
R9623:Syne1 UTSW 10 5202009 missense probably damaging 1.00
R9646:Syne1 UTSW 10 5229187 missense possibly damaging 0.95
R9666:Syne1 UTSW 10 5034937 missense probably damaging 1.00
R9677:Syne1 UTSW 10 5265125 missense probably damaging 1.00
R9695:Syne1 UTSW 10 5318461 missense probably benign 0.03
R9696:Syne1 UTSW 10 5347847 missense probably benign 0.00
R9719:Syne1 UTSW 10 5326601 missense possibly damaging 0.47
R9744:Syne1 UTSW 10 5324184 missense probably benign 0.01
R9761:Syne1 UTSW 10 5368190 critical splice donor site probably null
R9763:Syne1 UTSW 10 5057858 missense probably benign 0.31
RF010:Syne1 UTSW 10 5246386 missense possibly damaging 0.89
RF015:Syne1 UTSW 10 5302248 missense probably benign 0.01
RF023:Syne1 UTSW 10 5255482 missense probably damaging 1.00
X0017:Syne1 UTSW 10 5346917 missense probably damaging 1.00
X0025:Syne1 UTSW 10 5358973 nonsense probably null
X0063:Syne1 UTSW 10 5052354 missense probably damaging 1.00
Z1176:Syne1 UTSW 10 5248364 missense probably damaging 0.96
Z1176:Syne1 UTSW 10 5259280 missense probably benign
Z1176:Syne1 UTSW 10 5330251 missense probably benign 0.10
Z1177:Syne1 UTSW 10 5143230 missense possibly damaging 0.78
Z1177:Syne1 UTSW 10 5259349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGAACTTCTGCTCCATC -3'
(R):5'- GTTTAAAGACCCCTGAGCGTC -3'

Sequencing Primer
(F):5'- CAGCCTCAGTTTGTTTACAACATTG -3'
(R):5'- TTTAAAGACCCCTGAGCGTCCATAG -3'
Posted On 2022-04-18