Mutagenetix > Incidental Mutation

Incidental Mutation 'R9378:Appl1'

709810

Institutional Source

Beutler Lab

Gene Symbol

Appl1

Ensembl Gene

ENSMUSG00000040760

Gene Name

adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1

Synonyms

7330406P05Rik, 2900057D21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.166) question?

Stock #

R9378 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

26918988-26971232 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 26927827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 581 (R581*)

Ref Sequence

ENSEMBL: ENSMUSP00000042875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036570]

AlphaFold

Q8K3H0

Predicted Effect

probably null
Transcript: ENSMUST00000036570
AA Change: R581*

SMART Domains

Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: R581*

Domain	Start	End	E-Value	Type
Pfam:BAR_3	7	249	2.6e-66	PFAM
PH	278	377	1.4e-3	SMART
low complexity region	425	434	N/A	INTRINSIC
Pfam:PID	501	632	6.6e-12	PFAM
low complexity region	645	660	N/A	INTRINSIC
low complexity region	679	700	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007K13Rik	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	2: 28,466,110		probably benign	Het
2210408I21Rik	A	G	13: 77,323,616	K1047E	possibly damaging	Het
Abca14	A	T	7: 120,207,968	Y79F	possibly damaging	Het
Abca2	T	A	2: 25,439,082	M978K	probably benign	Het
Adamts3	A	T	5: 89,700,410	C684*	probably null	Het
Adnp2	T	C	18: 80,129,422	T591A	probably benign	Het
Aff4	A	T	11: 53,372,479	T109S	probably damaging	Het
Agmo	A	G	12: 37,243,721	I48V	probably benign	Het
Armc9	A	T	1: 86,262,044	M714L	probably benign	Het
Atp6v0d2	T	A	4: 19,922,377	T41S	probably benign	Het
Bin1	A	T	18: 32,419,868	Q182L	probably damaging	Het
Bmp10	A	G	6: 87,433,702	D159G	probably benign	Het
Bsn	G	A	9: 108,107,655	P295S	possibly damaging	Het
C130079G13Rik	A	G	3: 59,931,689	T11A	possibly damaging	Het
Cbx6	A	G	15: 79,828,405	S274P	probably damaging	Het
Cdc20b	A	G	13: 113,056,097	K108R	probably benign	Het
Ces1d	T	A	8: 93,186,096	N238I	probably damaging	Het
Col7a1	C	T	9: 108,958,640	Q663*	probably null	Het
Cpsf3	T	C	12: 21,308,038	I517T	possibly damaging	Het
Cyp2a5	C	A	7: 26,840,454	T309N	probably damaging	Het
Cyp2d40	A	G	15: 82,761,601	F68L	possibly damaging	Het
Cyp7b1	A	T	3: 18,096,673	W301R	probably damaging	Het
Dnah6	T	A	6: 73,212,530	N45I	probably benign	Het
Dnah7a	A	T	1: 53,582,617	H1116Q	probably benign	Het
Dntt	A	G	19: 41,038,917	N141S	probably benign	Het
Fbxl13	T	C	5: 21,585,203	N281D	probably damaging	Het
Frem2	A	T	3: 53,651,989	L1699H	probably damaging	Het
Gabrr3	T	C	16: 59,461,674	V464A	possibly damaging	Het
Gdap1	T	A	1: 17,157,129	I160N	probably damaging	Het
Hnrnpll	C	A	17: 80,061,862	R44L	unknown	Het
Hsp90ab1	T	C	17: 45,570,754	E187G	probably damaging	Het
Ighm	T	A	12: 113,422,590	T47S		Het
Itgb7	A	C	15: 102,227,396		probably null	Het
Kif16b	A	T	2: 142,619,818	C1293*	probably null	Het
Klf11	C	T	12: 24,655,044	R166C	probably benign	Het
Lca5l	T	A	16: 96,176,012	Q198L	probably damaging	Het
Lnx2	A	T	5: 147,024,370	M584K	probably benign	Het
Lpp	A	T	16: 24,721,987	M1L	probably benign	Het
Lrig3	A	G	10: 125,997,084	T276A	probably damaging	Het
Ltbp2	G	A	12: 84,791,090	P1192L	probably benign	Het
Megf8	A	T	7: 25,340,415		probably null	Het
Myh1	A	C	11: 67,202,433	T117P	probably damaging	Het
Neb	C	A	2: 52,244,101	R3290L	possibly damaging	Het
Neb	A	C	2: 52,247,292	V220G		Het
Nktr	A	T	9: 121,748,198	K444I	probably damaging	Het
Nol11	A	T	11: 107,173,679	M483K	probably benign	Het
Npy1r	C	A	8: 66,704,209	P94T	probably damaging	Het
Nsmaf	T	C	4: 6,440,940	T37A	probably benign	Het
Olfr1137	C	A	2: 87,711,079	V276F	possibly damaging	Het
Olfr1224-ps1	T	C	2: 89,157,055	N40S	probably damaging	Het
Olfr131	G	A	17: 38,082,165	A271V	possibly damaging	Het
Olfr160	A	G	9: 37,712,177	I34T	probably damaging	Het
Olfr286	A	G	15: 98,227,039	L204P	possibly damaging	Het
Olfr624	A	T	7: 103,670,182	M283K	probably damaging	Het
Olfr884	G	A	9: 38,047,479	V86M	possibly damaging	Het
Palld	C	T	8: 61,516,657	R1211H	unknown	Het
Pcdha3	A	G	18: 36,947,231	D342G	probably damaging	Het
Pclo	G	A	5: 14,765,863	V1266I		Het
Pcnx4	T	C	12: 72,555,890	Y309H	probably damaging	Het
Pde8a	C	T	7: 81,332,871	T746I	probably damaging	Het
Pdzrn3	T	G	6: 101,150,811	K965Q	probably damaging	Het
Phldb1	G	A	9: 44,704,128	A225V	probably benign	Het
Plat	A	G	8: 22,775,583	Y214C	probably damaging	Het
Plppr1	T	A	4: 49,325,627	C274*	probably null	Het
Poglut1	A	G	16: 38,526,771	F345L	possibly damaging	Het
Ppara	A	T	15: 85,777,636	E26V	possibly damaging	Het
Ppcdc	A	T	9: 57,420,288	W79R	probably damaging	Het
Prdm1	C	T	10: 44,440,154	C662Y	probably damaging	Het
Sgms2	G	A	3: 131,342,362		probably benign	Het
Slc31a1	T	A	4: 62,388,606	M133K	probably damaging	Het
Smg1	G	A	7: 118,178,775	Q1309*	probably null	Het
Sos1	T	C	17: 80,453,810	I152M	probably damaging	Het
Stk4	A	T	2: 164,110,216		probably benign	Het
Syne1	T	G	10: 5,250,954	N3538T	probably damaging	Het
Tbc1d16	A	G	11: 119,208,840	F236S	probably damaging	Het
Tgs1	T	A	4: 3,595,475	M548K	probably benign	Het
Twf1	G	A	15: 94,585,455	T124I	probably damaging	Het
Tyro3	G	A	2: 119,812,167	G611R	probably damaging	Het
Unc13b	T	A	4: 43,173,282	I1370K	unknown	Het
Usp40	A	G	1: 87,957,310	W939R	probably damaging	Het
Vamp8	A	T	6: 72,385,571	V82E	probably damaging	Het
Vmn2r17	A	G	5: 109,427,866	H201R	possibly damaging	Het
Whrn	T	C	4: 63,431,842	H546R	probably benign	Het
Yeats2	T	C	16: 20,214,478	V1036A	probably benign	Het
Zfp352	T	G	4: 90,224,338	N238K	probably benign	Het
Zfp36l3	TCCAGGGGCGAGGGCAGCCCCAGGAGCAAGGGCCGCCCTAGGAATGAGGGCCGCCCCAGG	TCCAGG	X: 53,774,554		probably benign	Het
Zfp462	T	A	4: 55,011,510	S1159T	probably benign	Het
Zscan4-ps1	A	T	7: 11,066,265	H232Q	probably benign	Het

Other mutations in Appl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Appl1	APN	14	26949476	missense	possibly damaging	0.89
IGL01615:Appl1	APN	14	26959470	splice site	probably benign
IGL01633:Appl1	APN	14	26962838	missense	probably damaging	0.99
IGL01945:Appl1	APN	14	26928655	missense	possibly damaging	0.80
IGL02210:Appl1	APN	14	26925952	splice site	probably benign
IGL02650:Appl1	APN	14	26950708	missense	possibly damaging	0.76
IGL02674:Appl1	APN	14	26949461	missense	possibly damaging	0.86
IGL02803:Appl1	APN	14	26951516	missense	possibly damaging	0.93
R0129:Appl1	UTSW	14	26928643	missense	probably damaging	1.00
R0183:Appl1	UTSW	14	26962854	missense	probably damaging	1.00
R0323:Appl1	UTSW	14	26942738	missense	possibly damaging	0.91
R0411:Appl1	UTSW	14	26940256	missense	probably benign
R1213:Appl1	UTSW	14	26943993	missense	probably benign	0.27
R1277:Appl1	UTSW	14	26927856	missense	possibly damaging	0.87
R1668:Appl1	UTSW	14	26923854	missense	probably damaging	1.00
R1856:Appl1	UTSW	14	26927749	missense	probably damaging	1.00
R1889:Appl1	UTSW	14	26925513	splice site	probably benign
R2145:Appl1	UTSW	14	26949619	missense	possibly damaging	0.66
R3720:Appl1	UTSW	14	26927844	missense	probably damaging	1.00
R3722:Appl1	UTSW	14	26927844	missense	probably damaging	1.00
R3917:Appl1	UTSW	14	26928604	missense	probably damaging	1.00
R4700:Appl1	UTSW	14	26925971	missense	probably benign	0.00
R5139:Appl1	UTSW	14	26947155	missense	probably benign	0.04
R5485:Appl1	UTSW	14	26962866	missense	probably damaging	1.00
R5536:Appl1	UTSW	14	26923780	nonsense	probably null
R5795:Appl1	UTSW	14	26942816	missense	probably benign	0.01
R7044:Appl1	UTSW	14	26928677	missense	possibly damaging	0.90
R7318:Appl1	UTSW	14	26963660	missense	probably benign	0.01
R7447:Appl1	UTSW	14	26959452	nonsense	probably null
R7943:Appl1	UTSW	14	26945568	missense	probably benign	0.01
R8110:Appl1	UTSW	14	26927794	nonsense	probably null
R8129:Appl1	UTSW	14	26949509	missense	possibly damaging	0.87
R8160:Appl1	UTSW	14	26928635	missense	probably benign	0.35
R8211:Appl1	UTSW	14	26945598	missense	probably benign	0.18
R8239:Appl1	UTSW	14	26964957	missense	probably damaging	0.99
R8379:Appl1	UTSW	14	26925415	critical splice donor site	probably null
R8464:Appl1	UTSW	14	26953028	nonsense	probably null
R8699:Appl1	UTSW	14	26940255	missense	probably benign
R9023:Appl1	UTSW	14	26963695	missense	possibly damaging	0.93
R9090:Appl1	UTSW	14	26947127	missense	probably benign	0.01
R9203:Appl1	UTSW	14	26961013	nonsense	probably null
R9227:Appl1	UTSW	14	26923735	missense	unknown
R9230:Appl1	UTSW	14	26923735	missense	unknown
R9243:Appl1	UTSW	14	26927753	missense	possibly damaging	0.62
R9271:Appl1	UTSW	14	26947127	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACTAGGCGTAATCGGAGAGC -3'
(R):5'- GTTTATGCACCAAAGGAATTAGCAG -3'

Sequencing Primer
(F):5'- AATCGGAGAGCTTTTCCCAG -3'
(R):5'- CACCAAAGGAATTAGCAGAAGTAATC -3'

Posted On

2022-04-18