Incidental Mutation 'R9379:Plxna2'
ID 709839
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Name plexin A2
Synonyms PlexA2, 2810428A13Rik, Plxn2, OCT
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9379 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 194302020-194499177 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 194492474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1777 (T1777I)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
AlphaFold P70207
PDB Structure Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027952
AA Change: T1777I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: T1777I

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,451,201 (GRCm39) I136F possibly damaging Het
1700019D03Rik T A 1: 52,964,635 (GRCm39) D31V probably benign Het
Abca14 G T 7: 119,807,202 (GRCm39) E83* probably null Het
Abcc5 T C 16: 20,152,437 (GRCm39) T1370A probably damaging Het
Ankhd1 T C 18: 36,777,680 (GRCm39) V1621A probably benign Het
Ano8 T A 8: 71,936,178 (GRCm39) Q206L probably benign Het
Aox3 A T 1: 58,208,959 (GRCm39) I831F possibly damaging Het
Atp2a2 T C 5: 122,611,315 (GRCm39) I168V probably benign Het
Atxn2 G A 5: 121,885,509 (GRCm39) V239I probably damaging Het
B230219D22Rik C A 13: 55,847,283 (GRCm39) A132E probably damaging Het
Btbd17 C A 11: 114,682,749 (GRCm39) W321L possibly damaging Het
Cacna1i T A 15: 80,259,495 (GRCm39) V1255E probably damaging Het
Camsap1 T C 2: 25,846,318 (GRCm39) I132V Het
Chd7 A G 4: 8,752,210 (GRCm39) S236G unknown Het
Clasp1 CCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTG 1: 118,509,157 (GRCm39) probably benign Het
Clasp1 TGC TGCCGC 1: 118,509,168 (GRCm39) probably benign Het
Col4a1 T A 8: 11,249,838 (GRCm39) H1658L unknown Het
D630044L22Rik A G 17: 26,180,856 (GRCm39) H102R possibly damaging Het
Dact3 G A 7: 16,620,013 (GRCm39) V503I unknown Het
Dcn G T 10: 97,343,643 (GRCm39) R201L probably damaging Het
Dmxl1 T C 18: 50,024,567 (GRCm39) V1747A possibly damaging Het
Dnajc14 T A 10: 128,652,743 (GRCm39) probably null Het
Dspp A T 5: 104,322,760 (GRCm39) probably null Het
Ep300 T C 15: 81,532,760 (GRCm39) V1666A unknown Het
Flvcr2 A G 12: 85,850,000 (GRCm39) I429V probably benign Het
Gpr158 A G 2: 21,373,042 (GRCm39) probably benign Het
Grip1 G T 10: 119,780,961 (GRCm39) L203F probably damaging Het
Hoga1 T C 19: 42,051,697 (GRCm39) L250P probably damaging Het
Htr2b A G 1: 86,027,844 (GRCm39) S221P probably damaging Het
Ighv1-24 T C 12: 114,736,663 (GRCm39) Y79C possibly damaging Het
Katnip T C 7: 125,469,848 (GRCm39) L1439P probably damaging Het
Kcnq1 A G 7: 142,745,169 (GRCm39) T311A probably damaging Het
Kif21a C T 15: 90,854,030 (GRCm39) R779Q probably damaging Het
Lilra6 T C 7: 3,916,166 (GRCm39) E231G probably damaging Het
Lrrc8c T A 5: 105,756,356 (GRCm39) Y710* probably null Het
Mixl1 A G 1: 180,522,258 (GRCm39) S208P probably benign Het
Muc16 T A 9: 18,557,467 (GRCm39) Q2942L unknown Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nlrp4e C G 7: 23,020,755 (GRCm39) A414G probably benign Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Nup85 T C 11: 115,469,424 (GRCm39) I322T probably benign Het
Odad1 A G 7: 45,597,116 (GRCm39) T456A probably benign Het
Odad2 T C 18: 7,265,089 (GRCm39) D426G possibly damaging Het
Or10n7-ps1 A G 9: 39,598,114 (GRCm39) L42P probably damaging Het
Or7e169 T A 9: 19,757,212 (GRCm39) K234N possibly damaging Het
Or8b4 C T 9: 37,830,447 (GRCm39) L165F probably damaging Het
Or9k2b A G 10: 130,016,605 (GRCm39) M48T possibly damaging Het
Osbpl9 A T 4: 108,940,399 (GRCm39) H178Q probably damaging Het
Parp14 A G 16: 35,680,853 (GRCm39) V260A probably benign Het
Ppp3cb T C 14: 20,581,874 (GRCm39) D47G probably benign Het
Pram1 T C 17: 33,860,441 (GRCm39) V336A probably damaging Het
Prl T A 13: 27,243,503 (GRCm39) I58N probably damaging Het
Qrich2 T C 11: 116,348,934 (GRCm39) D630G unknown Het
Ralgapa1 G C 12: 55,769,583 (GRCm39) P803A probably damaging Het
Rtcb A T 10: 85,779,071 (GRCm39) probably null Het
Ryr2 C T 13: 11,898,002 (GRCm39) C131Y probably damaging Het
Spata7 A G 12: 98,600,548 (GRCm39) I54V probably benign Het
St6galnac3 A G 3: 153,215,070 (GRCm39) V28A probably benign Het
Stra6l A T 4: 45,849,093 (GRCm39) T6S probably benign Het
Taf4b C T 18: 14,946,431 (GRCm39) T418M probably damaging Het
Taf6 A G 5: 138,181,952 (GRCm39) I92T possibly damaging Het
Tcaf2 C T 6: 42,619,517 (GRCm39) S170N probably benign Het
Tfrc A G 16: 32,443,819 (GRCm39) D541G probably damaging Het
Trav13n-3 T G 14: 53,574,853 (GRCm39) L32V probably damaging Het
Trpa1 T C 1: 14,966,739 (GRCm39) T542A possibly damaging Het
Ttc39b A T 4: 83,189,376 (GRCm39) S53T probably benign Het
Tut7 T C 13: 59,936,288 (GRCm39) Y1271C possibly damaging Het
Ubap2 A T 4: 41,216,630 (GRCm39) S268T possibly damaging Het
Usp40 A G 1: 87,881,889 (GRCm39) V998A probably benign Het
Usp44 T A 10: 93,688,635 (GRCm39) I562K possibly damaging Het
Vmn2r106 T C 17: 20,496,066 (GRCm39) T553A probably damaging Het
Vmn2r65 A G 7: 84,596,650 (GRCm39) V135A probably damaging Het
Wbp2nl T A 15: 82,198,311 (GRCm39) S283T possibly damaging Het
Wnk1 G A 6: 119,928,678 (GRCm39) T1092I probably damaging Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194,326,965 (GRCm39) missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194,472,138 (GRCm39) missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194,482,876 (GRCm39) missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194,326,404 (GRCm39) missense probably benign 0.03
IGL00704:Plxna2 APN 1 194,433,769 (GRCm39) missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194,428,547 (GRCm39) splice site probably benign
IGL01078:Plxna2 APN 1 194,469,001 (GRCm39) unclassified probably benign
IGL01354:Plxna2 APN 1 194,444,743 (GRCm39) missense probably benign 0.02
IGL01432:Plxna2 APN 1 194,326,626 (GRCm39) missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194,446,878 (GRCm39) missense probably benign 0.00
IGL01525:Plxna2 APN 1 194,394,619 (GRCm39) missense probably benign 0.00
IGL01656:Plxna2 APN 1 194,472,469 (GRCm39) missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194,471,210 (GRCm39) missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194,326,258 (GRCm39) missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194,433,796 (GRCm39) missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194,482,084 (GRCm39) missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194,476,691 (GRCm39) missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194,326,732 (GRCm39) missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194,434,397 (GRCm39) missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194,326,272 (GRCm39) missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194,428,458 (GRCm39) missense probably benign 0.10
IGL02545:Plxna2 APN 1 194,468,998 (GRCm39) unclassified probably benign
IGL02553:Plxna2 APN 1 194,433,746 (GRCm39) missense probably benign 0.08
IGL02882:Plxna2 APN 1 194,444,878 (GRCm39) missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194,431,617 (GRCm39) splice site probably benign
IGL03062:Plxna2 APN 1 194,444,858 (GRCm39) missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194,483,435 (GRCm39) missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194,487,253 (GRCm39) missense probably damaging 0.99
G1Funyon:Plxna2 UTSW 1 194,472,483 (GRCm39) missense probably benign 0.01
PIT4514001:Plxna2 UTSW 1 194,477,245 (GRCm39) missense probably benign 0.00
R0024:Plxna2 UTSW 1 194,326,303 (GRCm39) missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194,326,204 (GRCm39) missense probably benign 0.13
R0040:Plxna2 UTSW 1 194,326,204 (GRCm39) missense probably benign 0.13
R0063:Plxna2 UTSW 1 194,327,247 (GRCm39) missense probably benign 0.00
R0063:Plxna2 UTSW 1 194,327,247 (GRCm39) missense probably benign 0.00
R0217:Plxna2 UTSW 1 194,326,906 (GRCm39) missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194,326,458 (GRCm39) missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194,326,712 (GRCm39) nonsense probably null
R0505:Plxna2 UTSW 1 194,326,656 (GRCm39) missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194,433,694 (GRCm39) missense probably benign 0.00
R0669:Plxna2 UTSW 1 194,471,145 (GRCm39) missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194,331,783 (GRCm39) missense probably benign 0.00
R0885:Plxna2 UTSW 1 194,326,864 (GRCm39) missense probably benign
R0898:Plxna2 UTSW 1 194,479,332 (GRCm39) missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194,482,863 (GRCm39) missense probably benign 0.01
R1061:Plxna2 UTSW 1 194,326,401 (GRCm39) missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194,462,818 (GRCm39) splice site probably null
R1222:Plxna2 UTSW 1 194,482,957 (GRCm39) missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194,326,794 (GRCm39) missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194,487,247 (GRCm39) nonsense probably null
R1432:Plxna2 UTSW 1 194,449,771 (GRCm39) missense probably benign 0.10
R1434:Plxna2 UTSW 1 194,433,848 (GRCm39) splice site probably benign
R1597:Plxna2 UTSW 1 194,431,614 (GRCm39) splice site probably benign
R1719:Plxna2 UTSW 1 194,326,678 (GRCm39) missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194,493,278 (GRCm39) missense probably benign 0.01
R1795:Plxna2 UTSW 1 194,488,611 (GRCm39) missense probably damaging 0.99
R1819:Plxna2 UTSW 1 194,472,494 (GRCm39) missense probably benign 0.03
R1926:Plxna2 UTSW 1 194,444,758 (GRCm39) missense probably benign 0.02
R1966:Plxna2 UTSW 1 194,327,008 (GRCm39) missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194,326,297 (GRCm39) missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194,326,297 (GRCm39) missense probably damaging 1.00
R2034:Plxna2 UTSW 1 194,462,902 (GRCm39) missense probably benign 0.00
R2131:Plxna2 UTSW 1 194,327,058 (GRCm39) missense probably benign 0.01
R2171:Plxna2 UTSW 1 194,482,925 (GRCm39) missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194,480,056 (GRCm39) missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194,480,039 (GRCm39) missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194,471,193 (GRCm39) missense probably benign 0.42
R3783:Plxna2 UTSW 1 194,489,829 (GRCm39) missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194,326,925 (GRCm39) missense probably benign
R3787:Plxna2 UTSW 1 194,326,242 (GRCm39) missense probably benign 0.10
R3845:Plxna2 UTSW 1 194,476,098 (GRCm39) missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194,428,465 (GRCm39) missense probably benign 0.02
R3930:Plxna2 UTSW 1 194,477,218 (GRCm39) missense probably benign 0.17
R3964:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R3980:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194,462,935 (GRCm39) missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194,326,762 (GRCm39) missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194,327,083 (GRCm39) missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194,431,625 (GRCm39) missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194,493,296 (GRCm39) missense possibly damaging 0.91
R4622:Plxna2 UTSW 1 194,494,458 (GRCm39) missense probably benign
R4623:Plxna2 UTSW 1 194,494,458 (GRCm39) missense probably benign
R4684:Plxna2 UTSW 1 194,444,902 (GRCm39) missense probably benign 0.42
R4688:Plxna2 UTSW 1 194,326,753 (GRCm39) missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194,480,040 (GRCm39) missense probably benign 0.39
R4876:Plxna2 UTSW 1 194,326,083 (GRCm39) missense probably benign 0.02
R5161:Plxna2 UTSW 1 194,433,712 (GRCm39) missense probably benign
R5207:Plxna2 UTSW 1 194,471,207 (GRCm39) missense probably benign 0.19
R5479:Plxna2 UTSW 1 194,476,181 (GRCm39) missense probably benign
R5931:Plxna2 UTSW 1 194,493,178 (GRCm39) missense probably damaging 1.00
R6026:Plxna2 UTSW 1 194,482,122 (GRCm39) missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194,481,883 (GRCm39) missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194,476,735 (GRCm39) missense probably benign 0.00
R6059:Plxna2 UTSW 1 194,493,279 (GRCm39) missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194,472,504 (GRCm39) missense probably benign 0.01
R6322:Plxna2 UTSW 1 194,436,675 (GRCm39) missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194,492,396 (GRCm39) missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194,472,074 (GRCm39) missense probably benign 0.01
R6748:Plxna2 UTSW 1 194,476,490 (GRCm39) splice site probably null
R6838:Plxna2 UTSW 1 194,487,222 (GRCm39) missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194,476,136 (GRCm39) missense probably benign 0.08
R7069:Plxna2 UTSW 1 194,476,212 (GRCm39) missense possibly damaging 0.51
R7122:Plxna2 UTSW 1 194,326,876 (GRCm39) nonsense probably null
R7145:Plxna2 UTSW 1 194,331,830 (GRCm39) missense probably benign 0.31
R7189:Plxna2 UTSW 1 194,483,366 (GRCm39) missense possibly damaging 0.58
R7207:Plxna2 UTSW 1 194,326,327 (GRCm39) missense probably damaging 1.00
R7232:Plxna2 UTSW 1 194,394,568 (GRCm39) missense probably damaging 1.00
R7234:Plxna2 UTSW 1 194,488,698 (GRCm39) missense probably damaging 0.96
R7246:Plxna2 UTSW 1 194,326,590 (GRCm39) missense possibly damaging 0.74
R7255:Plxna2 UTSW 1 194,434,411 (GRCm39) missense probably benign 0.03
R7283:Plxna2 UTSW 1 194,327,191 (GRCm39) missense probably damaging 0.99
R7288:Plxna2 UTSW 1 194,479,227 (GRCm39) missense probably damaging 1.00
R7361:Plxna2 UTSW 1 194,482,087 (GRCm39) missense probably damaging 1.00
R7424:Plxna2 UTSW 1 194,488,647 (GRCm39) missense probably damaging 0.98
R7501:Plxna2 UTSW 1 194,326,203 (GRCm39) missense possibly damaging 0.95
R7528:Plxna2 UTSW 1 194,494,464 (GRCm39) missense probably damaging 1.00
R7529:Plxna2 UTSW 1 194,326,179 (GRCm39) missense probably benign 0.25
R7532:Plxna2 UTSW 1 194,327,127 (GRCm39) missense probably benign 0.13
R7959:Plxna2 UTSW 1 194,493,270 (GRCm39) missense probably damaging 1.00
R7959:Plxna2 UTSW 1 194,476,172 (GRCm39) frame shift probably null
R7960:Plxna2 UTSW 1 194,476,172 (GRCm39) frame shift probably null
R8261:Plxna2 UTSW 1 194,431,724 (GRCm39) missense probably damaging 1.00
R8301:Plxna2 UTSW 1 194,472,483 (GRCm39) missense probably benign 0.01
R8463:Plxna2 UTSW 1 194,326,354 (GRCm39) missense probably damaging 1.00
R8519:Plxna2 UTSW 1 194,476,266 (GRCm39) missense probably damaging 1.00
R8836:Plxna2 UTSW 1 194,479,243 (GRCm39) missense possibly damaging 0.94
R9010:Plxna2 UTSW 1 194,471,217 (GRCm39) missense possibly damaging 0.95
R9034:Plxna2 UTSW 1 194,476,197 (GRCm39) missense probably damaging 1.00
R9254:Plxna2 UTSW 1 194,492,474 (GRCm39) missense probably damaging 1.00
R9274:Plxna2 UTSW 1 194,471,136 (GRCm39) missense probably damaging 1.00
R9385:Plxna2 UTSW 1 194,431,724 (GRCm39) missense possibly damaging 0.95
R9422:Plxna2 UTSW 1 194,326,730 (GRCm39) missense probably damaging 1.00
R9451:Plxna2 UTSW 1 194,326,692 (GRCm39) missense probably benign 0.05
R9484:Plxna2 UTSW 1 194,327,202 (GRCm39) missense probably damaging 1.00
X0027:Plxna2 UTSW 1 194,326,741 (GRCm39) missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194,446,847 (GRCm39) missense probably benign 0.06
Z1088:Plxna2 UTSW 1 194,326,749 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TCCTGTTGGACCAGTTTCTG -3'
(R):5'- TGAGGTCCTGCTCTTCAGTG -3'

Sequencing Primer
(F):5'- TGCTCTACCATTCAGCAGTAAGGG -3'
(R):5'- AGTGGCCACTGATGCTCACAG -3'
Posted On 2022-04-18