Incidental Mutation 'R9379:Usp44'
ID 709873
Institutional Source Beutler Lab
Gene Symbol Usp44
Ensembl Gene ENSMUSG00000020020
Gene Name ubiquitin specific peptidase 44
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9379 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 93831555-93858088 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93852773 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 562 (I562K)
Ref Sequence ENSEMBL: ENSMUSP00000149020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095333] [ENSMUST00000216224]
AlphaFold Q8C2S0
Predicted Effect probably benign
Transcript: ENSMUST00000095333
SMART Domains Protein: ENSMUSP00000092975
Gene: ENSMUSG00000020020

DomainStartEndE-ValueType
Pfam:zf-UBP 26 88 5.4e-23 PFAM
Pfam:UCH 161 480 3.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216224
AA Change: I562K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit chromosomal instability, aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,451,201 I136F possibly damaging Het
1700019D03Rik T A 1: 52,925,476 D31V probably benign Het
Abca14 G T 7: 120,207,979 E83* probably null Het
Abcc5 T C 16: 20,333,687 T1370A probably damaging Het
Ankhd1 T C 18: 36,644,627 V1621A probably benign Het
Ano8 T A 8: 71,483,534 Q206L probably benign Het
Aox3 A T 1: 58,169,800 I831F possibly damaging Het
Armc4 T C 18: 7,265,089 D426G possibly damaging Het
Atp2a2 T C 5: 122,473,252 I168V probably benign Het
Atxn2 G A 5: 121,747,446 V239I probably damaging Het
B230219D22Rik C A 13: 55,699,470 A132E probably damaging Het
Btbd17 C A 11: 114,791,923 W321L possibly damaging Het
Cacna1i T A 15: 80,375,294 V1255E probably damaging Het
Camsap1 T C 2: 25,956,306 I132V Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Chd7 A G 4: 8,752,210 S236G unknown Het
Clasp1 CCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTG 1: 118,581,427 probably benign Het
Clasp1 TGC TGCCGC 1: 118,581,438 probably benign Het
Col4a1 T A 8: 11,199,838 H1658L unknown Het
D430042O09Rik T C 7: 125,870,676 L1439P probably damaging Het
D630044L22Rik A G 17: 25,961,882 H102R possibly damaging Het
Dact3 G A 7: 16,886,088 V503I unknown Het
Dcn G T 10: 97,507,781 R201L probably damaging Het
Dmxl1 T C 18: 49,891,500 V1747A possibly damaging Het
Dnajc14 T A 10: 128,816,874 probably null Het
Dspp A T 5: 104,174,894 probably null Het
Ep300 T C 15: 81,648,559 V1666A unknown Het
Flvcr2 A G 12: 85,803,226 I429V probably benign Het
Gpr158 A G 2: 21,368,231 probably benign Het
Grip1 G T 10: 119,945,056 L203F probably damaging Het
Hoga1 T C 19: 42,063,258 L250P probably damaging Het
Htr2b A G 1: 86,100,122 S221P probably damaging Het
Ighv1-24 T C 12: 114,773,043 Y79C possibly damaging Het
Kcnq1 A G 7: 143,191,432 T311A probably damaging Het
Kif21a C T 15: 90,969,827 R779Q probably damaging Het
Lilra6 T C 7: 3,913,167 E231G probably damaging Het
Lrrc8c T A 5: 105,608,490 Y710* probably null Het
Mixl1 A G 1: 180,694,693 S208P probably benign Het
Muc16 T A 9: 18,646,171 Q2942L unknown Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nlrp4e C G 7: 23,321,330 A414G probably benign Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nup85 T C 11: 115,578,598 I322T probably benign Het
Olfr826 A G 10: 130,180,736 M48T possibly damaging Het
Olfr860 T A 9: 19,845,916 K234N possibly damaging Het
Olfr878 C T 9: 37,919,151 L165F probably damaging Het
Olfr964-ps1 A G 9: 39,686,818 L42P probably damaging Het
Osbpl9 A T 4: 109,083,202 H178Q probably damaging Het
Parp14 A G 16: 35,860,483 V260A probably benign Het
Plxna2 C T 1: 194,810,166 T1777I probably damaging Het
Ppp3cb T C 14: 20,531,806 D47G probably benign Het
Pram1 T C 17: 33,641,467 V336A probably damaging Het
Prl T A 13: 27,059,520 I58N probably damaging Het
Qrich2 T C 11: 116,458,108 D630G unknown Het
Ralgapa1 G C 12: 55,722,798 P803A probably damaging Het
Rtcb A T 10: 85,943,207 probably null Het
Ryr2 C T 13: 11,883,116 C131Y probably damaging Het
Spata7 A G 12: 98,634,289 I54V probably benign Het
St6galnac3 A G 3: 153,509,433 V28A probably benign Het
Stra6l A T 4: 45,849,093 T6S probably benign Het
Taf4b C T 18: 14,813,374 T418M probably damaging Het
Taf6 A G 5: 138,183,690 I92T possibly damaging Het
Tcaf2 C T 6: 42,642,583 S170N probably benign Het
Tfrc A G 16: 32,625,001 D541G probably damaging Het
Trav13n-3 T G 14: 53,337,396 L32V probably damaging Het
Trpa1 T C 1: 14,896,515 T542A possibly damaging Het
Ttc39b A T 4: 83,271,139 S53T probably benign Het
Ubap2 A T 4: 41,216,630 S268T possibly damaging Het
Usp40 A G 1: 87,954,167 V998A probably benign Het
Vmn2r106 T C 17: 20,275,804 T553A probably damaging Het
Vmn2r65 A G 7: 84,947,442 V135A probably damaging Het
Wbp2nl T A 15: 82,314,110 S283T possibly damaging Het
Wnk1 G A 6: 119,951,717 T1092I probably damaging Het
Zcchc6 T C 13: 59,788,474 Y1271C possibly damaging Het
Other mutations in Usp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Usp44 UTSW 10 93845655 start gained probably benign
R0497:Usp44 UTSW 10 93846806 missense possibly damaging 0.77
R0789:Usp44 UTSW 10 93847220 intron probably benign
R1521:Usp44 UTSW 10 93847186 nonsense probably null
R4032:Usp44 UTSW 10 93847265 intron probably benign
R4212:Usp44 UTSW 10 93846770 missense possibly damaging 0.55
R4755:Usp44 UTSW 10 93846906 missense probably damaging 1.00
R4764:Usp44 UTSW 10 93846071 missense probably benign 0.17
R5095:Usp44 UTSW 10 93846845 missense possibly damaging 0.70
R5775:Usp44 UTSW 10 93845978 missense possibly damaging 0.80
R6029:Usp44 UTSW 10 93846632 missense probably damaging 0.96
R6193:Usp44 UTSW 10 93847148 intron probably benign
R6233:Usp44 UTSW 10 93850340 missense probably damaging 1.00
R6338:Usp44 UTSW 10 93846513 missense probably damaging 1.00
R6374:Usp44 UTSW 10 93856310 missense probably benign 0.12
R6556:Usp44 UTSW 10 93846008 missense probably benign 0.20
R6615:Usp44 UTSW 10 93846489 missense possibly damaging 0.48
R7099:Usp44 UTSW 10 93850187 missense possibly damaging 0.95
R7224:Usp44 UTSW 10 93845993 missense probably benign 0.08
R7361:Usp44 UTSW 10 93846468 missense probably benign 0.00
R7576:Usp44 UTSW 10 93846428 missense probably damaging 0.99
R8014:Usp44 UTSW 10 93852709 critical splice acceptor site probably null
R8695:Usp44 UTSW 10 93846503 missense probably damaging 1.00
R8919:Usp44 UTSW 10 93857913 missense probably benign 0.00
R8950:Usp44 UTSW 10 93846267 missense possibly damaging 0.93
R9144:Usp44 UTSW 10 93845783 missense probably benign 0.09
R9254:Usp44 UTSW 10 93852773 missense possibly damaging 0.93
R9488:Usp44 UTSW 10 93846989 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCATCATGGTGCTAGACCTG -3'
(R):5'- TACATTAGCCAAGTATTCGGTGTTC -3'

Sequencing Primer
(F):5'- GTGGGTGTCACCTCCATCATG -3'
(R):5'- CGGTGTTCAAATGGAATCCACTG -3'
Posted On 2022-04-18