Incidental Mutation 'R9379:Usp44'
ID 709873
Institutional Source Beutler Lab
Gene Symbol Usp44
Ensembl Gene ENSMUSG00000020020
Gene Name ubiquitin specific peptidase 44
Synonyms E430004F17Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9379 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 93667417-93693950 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93688635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 562 (I562K)
Ref Sequence ENSEMBL: ENSMUSP00000149020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095333] [ENSMUST00000216224]
AlphaFold Q8C2S0
Predicted Effect probably benign
Transcript: ENSMUST00000095333
SMART Domains Protein: ENSMUSP00000092975
Gene: ENSMUSG00000020020

DomainStartEndE-ValueType
Pfam:zf-UBP 26 88 5.4e-23 PFAM
Pfam:UCH 161 480 3.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216224
AA Change: I562K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit chromosomal instability, aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,451,201 (GRCm39) I136F possibly damaging Het
1700019D03Rik T A 1: 52,964,635 (GRCm39) D31V probably benign Het
Abca14 G T 7: 119,807,202 (GRCm39) E83* probably null Het
Abcc5 T C 16: 20,152,437 (GRCm39) T1370A probably damaging Het
Ankhd1 T C 18: 36,777,680 (GRCm39) V1621A probably benign Het
Ano8 T A 8: 71,936,178 (GRCm39) Q206L probably benign Het
Aox3 A T 1: 58,208,959 (GRCm39) I831F possibly damaging Het
Atp2a2 T C 5: 122,611,315 (GRCm39) I168V probably benign Het
Atxn2 G A 5: 121,885,509 (GRCm39) V239I probably damaging Het
B230219D22Rik C A 13: 55,847,283 (GRCm39) A132E probably damaging Het
Btbd17 C A 11: 114,682,749 (GRCm39) W321L possibly damaging Het
Cacna1i T A 15: 80,259,495 (GRCm39) V1255E probably damaging Het
Camsap1 T C 2: 25,846,318 (GRCm39) I132V Het
Chd7 A G 4: 8,752,210 (GRCm39) S236G unknown Het
Clasp1 CCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTG 1: 118,509,157 (GRCm39) probably benign Het
Clasp1 TGC TGCCGC 1: 118,509,168 (GRCm39) probably benign Het
Col4a1 T A 8: 11,249,838 (GRCm39) H1658L unknown Het
D630044L22Rik A G 17: 26,180,856 (GRCm39) H102R possibly damaging Het
Dact3 G A 7: 16,620,013 (GRCm39) V503I unknown Het
Dcn G T 10: 97,343,643 (GRCm39) R201L probably damaging Het
Dmxl1 T C 18: 50,024,567 (GRCm39) V1747A possibly damaging Het
Dnajc14 T A 10: 128,652,743 (GRCm39) probably null Het
Dspp A T 5: 104,322,760 (GRCm39) probably null Het
Ep300 T C 15: 81,532,760 (GRCm39) V1666A unknown Het
Flvcr2 A G 12: 85,850,000 (GRCm39) I429V probably benign Het
Gpr158 A G 2: 21,373,042 (GRCm39) probably benign Het
Grip1 G T 10: 119,780,961 (GRCm39) L203F probably damaging Het
Hoga1 T C 19: 42,051,697 (GRCm39) L250P probably damaging Het
Htr2b A G 1: 86,027,844 (GRCm39) S221P probably damaging Het
Ighv1-24 T C 12: 114,736,663 (GRCm39) Y79C possibly damaging Het
Katnip T C 7: 125,469,848 (GRCm39) L1439P probably damaging Het
Kcnq1 A G 7: 142,745,169 (GRCm39) T311A probably damaging Het
Kif21a C T 15: 90,854,030 (GRCm39) R779Q probably damaging Het
Lilra6 T C 7: 3,916,166 (GRCm39) E231G probably damaging Het
Lrrc8c T A 5: 105,756,356 (GRCm39) Y710* probably null Het
Mixl1 A G 1: 180,522,258 (GRCm39) S208P probably benign Het
Muc16 T A 9: 18,557,467 (GRCm39) Q2942L unknown Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nlrp4e C G 7: 23,020,755 (GRCm39) A414G probably benign Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Nup85 T C 11: 115,469,424 (GRCm39) I322T probably benign Het
Odad1 A G 7: 45,597,116 (GRCm39) T456A probably benign Het
Odad2 T C 18: 7,265,089 (GRCm39) D426G possibly damaging Het
Or10n7-ps1 A G 9: 39,598,114 (GRCm39) L42P probably damaging Het
Or7e169 T A 9: 19,757,212 (GRCm39) K234N possibly damaging Het
Or8b4 C T 9: 37,830,447 (GRCm39) L165F probably damaging Het
Or9k2b A G 10: 130,016,605 (GRCm39) M48T possibly damaging Het
Osbpl9 A T 4: 108,940,399 (GRCm39) H178Q probably damaging Het
Parp14 A G 16: 35,680,853 (GRCm39) V260A probably benign Het
Plxna2 C T 1: 194,492,474 (GRCm39) T1777I probably damaging Het
Ppp3cb T C 14: 20,581,874 (GRCm39) D47G probably benign Het
Pram1 T C 17: 33,860,441 (GRCm39) V336A probably damaging Het
Prl T A 13: 27,243,503 (GRCm39) I58N probably damaging Het
Qrich2 T C 11: 116,348,934 (GRCm39) D630G unknown Het
Ralgapa1 G C 12: 55,769,583 (GRCm39) P803A probably damaging Het
Rtcb A T 10: 85,779,071 (GRCm39) probably null Het
Ryr2 C T 13: 11,898,002 (GRCm39) C131Y probably damaging Het
Spata7 A G 12: 98,600,548 (GRCm39) I54V probably benign Het
St6galnac3 A G 3: 153,215,070 (GRCm39) V28A probably benign Het
Stra6l A T 4: 45,849,093 (GRCm39) T6S probably benign Het
Taf4b C T 18: 14,946,431 (GRCm39) T418M probably damaging Het
Taf6 A G 5: 138,181,952 (GRCm39) I92T possibly damaging Het
Tcaf2 C T 6: 42,619,517 (GRCm39) S170N probably benign Het
Tfrc A G 16: 32,443,819 (GRCm39) D541G probably damaging Het
Trav13n-3 T G 14: 53,574,853 (GRCm39) L32V probably damaging Het
Trpa1 T C 1: 14,966,739 (GRCm39) T542A possibly damaging Het
Ttc39b A T 4: 83,189,376 (GRCm39) S53T probably benign Het
Tut7 T C 13: 59,936,288 (GRCm39) Y1271C possibly damaging Het
Ubap2 A T 4: 41,216,630 (GRCm39) S268T possibly damaging Het
Usp40 A G 1: 87,881,889 (GRCm39) V998A probably benign Het
Vmn2r106 T C 17: 20,496,066 (GRCm39) T553A probably damaging Het
Vmn2r65 A G 7: 84,596,650 (GRCm39) V135A probably damaging Het
Wbp2nl T A 15: 82,198,311 (GRCm39) S283T possibly damaging Het
Wnk1 G A 6: 119,928,678 (GRCm39) T1092I probably damaging Het
Other mutations in Usp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Usp44 UTSW 10 93,681,517 (GRCm39) start gained probably benign
R0497:Usp44 UTSW 10 93,682,668 (GRCm39) missense possibly damaging 0.77
R0789:Usp44 UTSW 10 93,683,082 (GRCm39) intron probably benign
R1521:Usp44 UTSW 10 93,683,048 (GRCm39) nonsense probably null
R4032:Usp44 UTSW 10 93,683,127 (GRCm39) intron probably benign
R4212:Usp44 UTSW 10 93,682,632 (GRCm39) missense possibly damaging 0.55
R4755:Usp44 UTSW 10 93,682,768 (GRCm39) missense probably damaging 1.00
R4764:Usp44 UTSW 10 93,681,933 (GRCm39) missense probably benign 0.17
R5095:Usp44 UTSW 10 93,682,707 (GRCm39) missense possibly damaging 0.70
R5775:Usp44 UTSW 10 93,681,840 (GRCm39) missense possibly damaging 0.80
R6029:Usp44 UTSW 10 93,682,494 (GRCm39) missense probably damaging 0.96
R6193:Usp44 UTSW 10 93,683,010 (GRCm39) intron probably benign
R6233:Usp44 UTSW 10 93,686,202 (GRCm39) missense probably damaging 1.00
R6338:Usp44 UTSW 10 93,682,375 (GRCm39) missense probably damaging 1.00
R6374:Usp44 UTSW 10 93,692,172 (GRCm39) missense probably benign 0.12
R6556:Usp44 UTSW 10 93,681,870 (GRCm39) missense probably benign 0.20
R6615:Usp44 UTSW 10 93,682,351 (GRCm39) missense possibly damaging 0.48
R7099:Usp44 UTSW 10 93,686,049 (GRCm39) missense possibly damaging 0.95
R7224:Usp44 UTSW 10 93,681,855 (GRCm39) missense probably benign 0.08
R7361:Usp44 UTSW 10 93,682,330 (GRCm39) missense probably benign 0.00
R7576:Usp44 UTSW 10 93,682,290 (GRCm39) missense probably damaging 0.99
R8014:Usp44 UTSW 10 93,688,571 (GRCm39) critical splice acceptor site probably null
R8695:Usp44 UTSW 10 93,682,365 (GRCm39) missense probably damaging 1.00
R8919:Usp44 UTSW 10 93,693,775 (GRCm39) missense probably benign 0.00
R8950:Usp44 UTSW 10 93,682,129 (GRCm39) missense possibly damaging 0.93
R9144:Usp44 UTSW 10 93,681,645 (GRCm39) missense probably benign 0.09
R9254:Usp44 UTSW 10 93,688,635 (GRCm39) missense possibly damaging 0.93
R9488:Usp44 UTSW 10 93,682,851 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCATCATGGTGCTAGACCTG -3'
(R):5'- TACATTAGCCAAGTATTCGGTGTTC -3'

Sequencing Primer
(F):5'- GTGGGTGTCACCTCCATCATG -3'
(R):5'- CGGTGTTCAAATGGAATCCACTG -3'
Posted On 2022-04-18