Incidental Mutation 'R9380:1600015I10Rik'
ID 709930
Institutional Source Beutler Lab
Gene Symbol 1600015I10Rik
Ensembl Gene ENSMUSG00000029813
Gene Name RIKEN cDNA 1600015I10 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R9380 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 48929895-48933687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48933130 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 667 (I667T)
Ref Sequence ENSEMBL: ENSMUSP00000031837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031837]
AlphaFold E9Q745
Predicted Effect probably damaging
Transcript: ENSMUST00000031837
AA Change: I667T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031837
Gene: ENSMUSG00000029813
AA Change: I667T

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 50 136 1.7e-25 PFAM
Pfam:Cu_amine_oxidN3 152 252 3.5e-16 PFAM
Pfam:Cu_amine_oxid 306 708 7.1e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 T G 1: 78,681,885 C85G possibly damaging Het
Alox12e A T 11: 70,316,168 probably null Het
Asb10 A C 5: 24,534,105 probably null Het
BC027072 A T 17: 71,749,356 S1109T possibly damaging Het
Bcl2a1d G A 9: 88,731,882 probably benign Het
Camsap3 A T 8: 3,603,999 K556N probably benign Het
Cd300lf T A 11: 115,124,327 T146S probably benign Het
Chuk C A 19: 44,074,519 A744S unknown Het
Clint1 A T 11: 45,852,161 M4L probably benign Het
Cnot4 T C 6: 35,052,930 I344M possibly damaging Het
Cpne1 T C 2: 156,078,801 D135G probably benign Het
Csgalnact2 C A 6: 118,128,879 L159F probably damaging Het
Dnaic2 T C 11: 114,745,163 F325L probably benign Het
Dnal4 G A 15: 79,763,589 S25L possibly damaging Het
Ep300 T C 15: 81,616,044 M515T unknown Het
Ewsr1 T C 11: 5,093,730 Y18C possibly damaging Het
Fam25c T C 14: 34,352,000 T72A possibly damaging Het
Flii T C 11: 60,715,471 Y1131C probably benign Het
Foxj1 C T 11: 116,331,721 A419T possibly damaging Het
Fsd1l A G 4: 53,693,991 T323A possibly damaging Het
Furin T C 7: 80,391,758 I551V probably benign Het
Gbp11 A G 5: 105,327,336 V382A probably benign Het
Gfod1 A C 13: 43,200,844 D218E probably damaging Het
Glp2r A T 11: 67,746,746 I153N possibly damaging Het
Gm11214 G T 4: 63,662,613 P100T possibly damaging Het
Gm34653 G A 2: 34,839,017 C276Y probably damaging Het
Gne A T 4: 44,066,807 F69I probably benign Het
Hsd3b2 T C 3: 98,712,137 K164R probably damaging Het
Hspa1b T C 17: 34,958,194 R272G probably damaging Het
Hydin C A 8: 110,563,872 T3321N probably benign Het
Impg1 A T 9: 80,381,795 S327T probably benign Het
Izumo2 T C 7: 44,715,388 V159A probably benign Het
Kat6b T C 14: 21,628,858 S430P probably damaging Het
Kcnj9 T A 1: 172,325,880 T226S probably benign Het
Kl T A 5: 150,988,877 M697K possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrrk1 G A 7: 66,278,583 P1266S probably damaging Het
Med13 A T 11: 86,286,772 N1499K probably benign Het
Mid1 C G X: 169,985,007 P384A probably benign Het
Mybbp1a A G 11: 72,442,842 I182V probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nin A G 12: 70,028,031 L1859P Het
Nlrp4e C G 7: 23,321,330 A414G probably benign Het
Olfr1200 A T 2: 88,768,186 I43N probably damaging Het
Olfr1380 A G 11: 49,564,077 D52G possibly damaging Het
Olfr728 C A 14: 50,140,313 G109W probably damaging Het
Olfr914 A G 9: 38,607,119 Y218C probably damaging Het
Osbpl8 T A 10: 111,273,119 S421T probably damaging Het
Paqr7 A G 4: 134,507,039 N69S probably damaging Het
Pdgfrb G A 18: 61,064,848 G231D probably damaging Het
Pip5k1b A G 19: 24,379,053 Y174H probably damaging Het
Pkd1 T A 17: 24,550,288 L9Q unknown Het
Psmg4 A T 13: 34,166,097 T71S probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Qser1 G A 2: 104,789,346 Q284* probably null Het
Rcc2 G T 4: 140,702,391 A79S probably benign Het
Rgl3 G T 9: 21,976,827 Q464K probably damaging Het
Rhov C A 2: 119,270,123 R211L probably benign Het
Rp1l1 A G 14: 64,029,026 D687G probably benign Het
Selenbp2 A G 3: 94,702,347 I291V probably benign Het
Sh3glb2 A T 2: 30,348,613 V189E probably damaging Het
Slc46a2 A G 4: 59,913,867 I352T probably damaging Het
Sucla2 T A 14: 73,590,872 N306K probably benign Het
Suco A G 1: 161,818,505 V1209A possibly damaging Het
Tacc2 T A 7: 130,625,041 L1152Q possibly damaging Het
Tanc1 A T 2: 59,835,452 K1185M probably damaging Het
Tas2r114 A G 6: 131,689,418 F216L probably benign Het
Tead1 A T 7: 112,841,898 H78L possibly damaging Het
Tex12 T C 9: 50,558,286 I64V possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Trank1 A G 9: 111,392,670 E2825G probably benign Het
Trappc13 T A 13: 104,144,199 Y399F probably damaging Het
Trim21 T C 7: 102,563,785 D102G probably damaging Het
Trim27 G T 13: 21,180,510 V6L probably benign Het
Trim55 A G 3: 19,674,395 T457A probably benign Het
Trrap A G 5: 144,833,171 E2716G probably benign Het
Usp10 T G 8: 119,956,204 L712R probably damaging Het
Vldlr T A 19: 27,238,792 C338S possibly damaging Het
Zfp946 A G 17: 22,454,699 I145V probably benign Het
Other mutations in 1600015I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:1600015I10Rik APN 6 48931040 missense probably damaging 1.00
IGL01347:1600015I10Rik APN 6 48932543 missense probably benign 0.02
IGL01751:1600015I10Rik APN 6 48930588 missense possibly damaging 0.79
IGL01915:1600015I10Rik APN 6 48931648 missense probably damaging 1.00
IGL02669:1600015I10Rik APN 6 48931473 missense probably damaging 1.00
IGL03033:1600015I10Rik APN 6 48932518 missense probably benign 0.00
IGL03242:1600015I10Rik APN 6 48932545 missense possibly damaging 0.68
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0448:1600015I10Rik UTSW 6 48933057 missense probably damaging 1.00
R1488:1600015I10Rik UTSW 6 48933447 missense possibly damaging 0.91
R1498:1600015I10Rik UTSW 6 48931371 missense probably benign 0.00
R1520:1600015I10Rik UTSW 6 48931297 nonsense probably null
R1922:1600015I10Rik UTSW 6 48931286 missense probably benign 0.00
R1992:1600015I10Rik UTSW 6 48930769 missense probably damaging 1.00
R1997:1600015I10Rik UTSW 6 48932429 missense probably damaging 0.98
R2021:1600015I10Rik UTSW 6 48931451 missense probably damaging 1.00
R3771:1600015I10Rik UTSW 6 48931196 missense probably damaging 1.00
R4208:1600015I10Rik UTSW 6 48931647 missense probably damaging 1.00
R4790:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5114:1600015I10Rik UTSW 6 48931358 missense probably benign 0.02
R5610:1600015I10Rik UTSW 6 48931019 missense probably benign 0.00
R5823:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5847:1600015I10Rik UTSW 6 48933478 missense probably damaging 1.00
R6233:1600015I10Rik UTSW 6 48930965 missense probably benign
R6357:1600015I10Rik UTSW 6 48930974 missense probably benign 0.00
R6694:1600015I10Rik UTSW 6 48930546 missense probably benign 0.21
R6733:1600015I10Rik UTSW 6 48930530 missense probably damaging 1.00
R6894:1600015I10Rik UTSW 6 48930662 missense probably damaging 1.00
R6898:1600015I10Rik UTSW 6 48931041 missense probably damaging 0.97
R6916:1600015I10Rik UTSW 6 48931053 missense probably benign 0.01
R7242:1600015I10Rik UTSW 6 48931128 missense probably damaging 1.00
R7762:1600015I10Rik UTSW 6 48932686 missense probably benign 0.07
R8257:1600015I10Rik UTSW 6 48932497 missense probably benign 0.04
R8391:1600015I10Rik UTSW 6 48932668 missense probably damaging 0.96
R8839:1600015I10Rik UTSW 6 48931040 missense probably damaging 1.00
R8863:1600015I10Rik UTSW 6 48930108 missense probably benign 0.00
R9266:1600015I10Rik UTSW 6 48930237 missense probably benign 0.00
R9274:1600015I10Rik UTSW 6 48930407 missense possibly damaging 0.94
R9382:1600015I10Rik UTSW 6 48930364 missense probably benign 0.08
R9562:1600015I10Rik UTSW 6 48930975 missense probably benign 0.01
R9565:1600015I10Rik UTSW 6 48930975 missense probably benign 0.01
X0062:1600015I10Rik UTSW 6 48933132 missense possibly damaging 0.55
Z1176:1600015I10Rik UTSW 6 48932468 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CAGATGCAACTCTAGTGCCCAG -3'
(R):5'- CTTCAGTGAACAGGGCAGAG -3'

Sequencing Primer
(F):5'- ACTCTAGTGCCCAGAGCCATTG -3'
(R):5'- TGAGTACTAGCCACCTGAGGTC -3'
Posted On 2022-04-18