Incidental Mutation 'R9380:Nlrp4e'
ID 709933
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene Name NLR family, pyrin domain containing 4E
Synonyms 4930406H16Rik, Nalp4e, Nalp-epsilon
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9380 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 23301192-23362277 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 23321330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glycine at position 414 (A414G)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
AlphaFold Q66X19
Predicted Effect probably benign
Transcript: ENSMUST00000076470
AA Change: A414G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: A414G

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,933,130 I667T probably damaging Het
Acsl3 T G 1: 78,681,885 C85G possibly damaging Het
Alox12e A T 11: 70,316,168 probably null Het
Asb10 A C 5: 24,534,105 probably null Het
BC027072 A T 17: 71,749,356 S1109T possibly damaging Het
Bcl2a1d G A 9: 88,731,882 probably benign Het
Camsap3 A T 8: 3,603,999 K556N probably benign Het
Cd300lf T A 11: 115,124,327 T146S probably benign Het
Chuk C A 19: 44,074,519 A744S unknown Het
Clint1 A T 11: 45,852,161 M4L probably benign Het
Cnot4 T C 6: 35,052,930 I344M possibly damaging Het
Cpne1 T C 2: 156,078,801 D135G probably benign Het
Csgalnact2 C A 6: 118,128,879 L159F probably damaging Het
Dnaic2 T C 11: 114,745,163 F325L probably benign Het
Dnal4 G A 15: 79,763,589 S25L possibly damaging Het
Ep300 T C 15: 81,616,044 M515T unknown Het
Ewsr1 T C 11: 5,093,730 Y18C possibly damaging Het
Fam25c T C 14: 34,352,000 T72A possibly damaging Het
Flii T C 11: 60,715,471 Y1131C probably benign Het
Foxj1 C T 11: 116,331,721 A419T possibly damaging Het
Fsd1l A G 4: 53,693,991 T323A possibly damaging Het
Furin T C 7: 80,391,758 I551V probably benign Het
Gbp11 A G 5: 105,327,336 V382A probably benign Het
Gfod1 A C 13: 43,200,844 D218E probably damaging Het
Glp2r A T 11: 67,746,746 I153N possibly damaging Het
Gm11214 G T 4: 63,662,613 P100T possibly damaging Het
Gm34653 G A 2: 34,839,017 C276Y probably damaging Het
Gne A T 4: 44,066,807 F69I probably benign Het
Hsd3b2 T C 3: 98,712,137 K164R probably damaging Het
Hspa1b T C 17: 34,958,194 R272G probably damaging Het
Hydin C A 8: 110,563,872 T3321N probably benign Het
Impg1 A T 9: 80,381,795 S327T probably benign Het
Izumo2 T C 7: 44,715,388 V159A probably benign Het
Kat6b T C 14: 21,628,858 S430P probably damaging Het
Kcnj9 T A 1: 172,325,880 T226S probably benign Het
Kl T A 5: 150,988,877 M697K possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrrk1 G A 7: 66,278,583 P1266S probably damaging Het
Med13 A T 11: 86,286,772 N1499K probably benign Het
Mid1 C G X: 169,985,007 P384A probably benign Het
Mybbp1a A G 11: 72,442,842 I182V probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nin A G 12: 70,028,031 L1859P Het
Olfr1200 A T 2: 88,768,186 I43N probably damaging Het
Olfr1380 A G 11: 49,564,077 D52G possibly damaging Het
Olfr728 C A 14: 50,140,313 G109W probably damaging Het
Olfr914 A G 9: 38,607,119 Y218C probably damaging Het
Osbpl8 T A 10: 111,273,119 S421T probably damaging Het
Paqr7 A G 4: 134,507,039 N69S probably damaging Het
Pdgfrb G A 18: 61,064,848 G231D probably damaging Het
Pip5k1b A G 19: 24,379,053 Y174H probably damaging Het
Pkd1 T A 17: 24,550,288 L9Q unknown Het
Psmg4 A T 13: 34,166,097 T71S probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Qser1 G A 2: 104,789,346 Q284* probably null Het
Rcc2 G T 4: 140,702,391 A79S probably benign Het
Rgl3 G T 9: 21,976,827 Q464K probably damaging Het
Rhov C A 2: 119,270,123 R211L probably benign Het
Rp1l1 A G 14: 64,029,026 D687G probably benign Het
Selenbp2 A G 3: 94,702,347 I291V probably benign Het
Sh3glb2 A T 2: 30,348,613 V189E probably damaging Het
Slc46a2 A G 4: 59,913,867 I352T probably damaging Het
Sucla2 T A 14: 73,590,872 N306K probably benign Het
Suco A G 1: 161,818,505 V1209A possibly damaging Het
Tacc2 T A 7: 130,625,041 L1152Q possibly damaging Het
Tanc1 A T 2: 59,835,452 K1185M probably damaging Het
Tas2r114 A G 6: 131,689,418 F216L probably benign Het
Tead1 A T 7: 112,841,898 H78L possibly damaging Het
Tex12 T C 9: 50,558,286 I64V possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Trank1 A G 9: 111,392,670 E2825G probably benign Het
Trappc13 T A 13: 104,144,199 Y399F probably damaging Het
Trim21 T C 7: 102,563,785 D102G probably damaging Het
Trim27 G T 13: 21,180,510 V6L probably benign Het
Trim55 A G 3: 19,674,395 T457A probably benign Het
Trrap A G 5: 144,833,171 E2716G probably benign Het
Usp10 T G 8: 119,956,204 L712R probably damaging Het
Vldlr T A 19: 27,238,792 C338S possibly damaging Het
Zfp946 A G 17: 22,454,699 I145V probably benign Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23343140 missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23340471 missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23321667 missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23353161 splice site probably benign
IGL01815:Nlrp4e APN 7 23321438 missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23320830 nonsense probably null
IGL02245:Nlrp4e APN 7 23320875 missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23321291 missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23321839 missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23301433 missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23301374 missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23320826 missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23353343 critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23320826 missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23355203 missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23321744 missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23320972 missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23353338 missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23321660 missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23320372 missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23321843 missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23321033 missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23320995 missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23321246 missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23355261 missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23321377 missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23340563 missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23320803 missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4387:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4389:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23321463 nonsense probably null
R4444:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23336866 missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23320979 missense probably benign
R4666:Nlrp4e UTSW 7 23336780 nonsense probably null
R4721:Nlrp4e UTSW 7 23321096 missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23321564 missense probably benign
R4758:Nlrp4e UTSW 7 23320618 missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23343100 missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23336740 missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23361893 nonsense probably null
R5277:Nlrp4e UTSW 7 23321438 missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23353173 missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23321765 missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23336891 missense probably benign 0.07
R5537:Nlrp4e UTSW 7 23320489 missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23321177 missense probably benign
R5683:Nlrp4e UTSW 7 23353272 missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23321306 missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23353172 missense probably benign
R6427:Nlrp4e UTSW 7 23320633 missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23321315 missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23336731 critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23321528 missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23321757 missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23320506 missense probably benign 0.06
R8445:Nlrp4e UTSW 7 23340540 missense probably benign 0.00
R8487:Nlrp4e UTSW 7 23321558 missense probably benign 0.00
R8906:Nlrp4e UTSW 7 23321131 missense possibly damaging 0.88
R9124:Nlrp4e UTSW 7 23320978 missense probably benign
R9167:Nlrp4e UTSW 7 23340526 missense probably benign 0.00
R9181:Nlrp4e UTSW 7 23361845 nonsense probably null
R9219:Nlrp4e UTSW 7 23321516 missense possibly damaging 0.50
R9229:Nlrp4e UTSW 7 23321374 missense probably benign 0.00
R9321:Nlrp4e UTSW 7 23321330 missense probably benign
R9323:Nlrp4e UTSW 7 23321330 missense probably benign
R9325:Nlrp4e UTSW 7 23321330 missense probably benign
R9379:Nlrp4e UTSW 7 23321330 missense probably benign
R9448:Nlrp4e UTSW 7 23301531 missense probably benign
X0022:Nlrp4e UTSW 7 23343119 missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23343178 missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23355223 missense possibly damaging 0.87
Predicted Primers
Posted On 2022-04-18