Incidental Mutation 'R9380:Trank1'
ID 709951
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Name tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9380 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 111311739-111395775 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111392670 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2825 (E2825G)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000078626
AA Change: E2825G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: E2825G

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,933,130 I667T probably damaging Het
Acsl3 T G 1: 78,681,885 C85G possibly damaging Het
Alox12e A T 11: 70,316,168 probably null Het
Asb10 A C 5: 24,534,105 probably null Het
BC027072 A T 17: 71,749,356 S1109T possibly damaging Het
Bcl2a1d G A 9: 88,731,882 probably benign Het
Camsap3 A T 8: 3,603,999 K556N probably benign Het
Cd300lf T A 11: 115,124,327 T146S probably benign Het
Chuk C A 19: 44,074,519 A744S unknown Het
Clint1 A T 11: 45,852,161 M4L probably benign Het
Cnot4 T C 6: 35,052,930 I344M possibly damaging Het
Cpne1 T C 2: 156,078,801 D135G probably benign Het
Csgalnact2 C A 6: 118,128,879 L159F probably damaging Het
Dnaic2 T C 11: 114,745,163 F325L probably benign Het
Dnal4 G A 15: 79,763,589 S25L possibly damaging Het
Ep300 T C 15: 81,616,044 M515T unknown Het
Ewsr1 T C 11: 5,093,730 Y18C possibly damaging Het
Fam25c T C 14: 34,352,000 T72A possibly damaging Het
Flii T C 11: 60,715,471 Y1131C probably benign Het
Foxj1 C T 11: 116,331,721 A419T possibly damaging Het
Fsd1l A G 4: 53,693,991 T323A possibly damaging Het
Furin T C 7: 80,391,758 I551V probably benign Het
Gbp11 A G 5: 105,327,336 V382A probably benign Het
Gfod1 A C 13: 43,200,844 D218E probably damaging Het
Glp2r A T 11: 67,746,746 I153N possibly damaging Het
Gm11214 G T 4: 63,662,613 P100T possibly damaging Het
Gm34653 G A 2: 34,839,017 C276Y probably damaging Het
Gne A T 4: 44,066,807 F69I probably benign Het
Hsd3b2 T C 3: 98,712,137 K164R probably damaging Het
Hspa1b T C 17: 34,958,194 R272G probably damaging Het
Hydin C A 8: 110,563,872 T3321N probably benign Het
Impg1 A T 9: 80,381,795 S327T probably benign Het
Izumo2 T C 7: 44,715,388 V159A probably benign Het
Kat6b T C 14: 21,628,858 S430P probably damaging Het
Kcnj9 T A 1: 172,325,880 T226S probably benign Het
Kl T A 5: 150,988,877 M697K possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrrk1 G A 7: 66,278,583 P1266S probably damaging Het
Med13 A T 11: 86,286,772 N1499K probably benign Het
Mid1 C G X: 169,985,007 P384A probably benign Het
Mybbp1a A G 11: 72,442,842 I182V probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nin A G 12: 70,028,031 L1859P Het
Nlrp4e C G 7: 23,321,330 A414G probably benign Het
Olfr1200 A T 2: 88,768,186 I43N probably damaging Het
Olfr1380 A G 11: 49,564,077 D52G possibly damaging Het
Olfr728 C A 14: 50,140,313 G109W probably damaging Het
Olfr914 A G 9: 38,607,119 Y218C probably damaging Het
Osbpl8 T A 10: 111,273,119 S421T probably damaging Het
Paqr7 A G 4: 134,507,039 N69S probably damaging Het
Pdgfrb G A 18: 61,064,848 G231D probably damaging Het
Pip5k1b A G 19: 24,379,053 Y174H probably damaging Het
Pkd1 T A 17: 24,550,288 L9Q unknown Het
Psmg4 A T 13: 34,166,097 T71S probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Qser1 G A 2: 104,789,346 Q284* probably null Het
Rcc2 G T 4: 140,702,391 A79S probably benign Het
Rgl3 G T 9: 21,976,827 Q464K probably damaging Het
Rhov C A 2: 119,270,123 R211L probably benign Het
Rp1l1 A G 14: 64,029,026 D687G probably benign Het
Selenbp2 A G 3: 94,702,347 I291V probably benign Het
Sh3glb2 A T 2: 30,348,613 V189E probably damaging Het
Slc46a2 A G 4: 59,913,867 I352T probably damaging Het
Sucla2 T A 14: 73,590,872 N306K probably benign Het
Suco A G 1: 161,818,505 V1209A possibly damaging Het
Tacc2 T A 7: 130,625,041 L1152Q possibly damaging Het
Tanc1 A T 2: 59,835,452 K1185M probably damaging Het
Tas2r114 A G 6: 131,689,418 F216L probably benign Het
Tead1 A T 7: 112,841,898 H78L possibly damaging Het
Tex12 T C 9: 50,558,286 I64V possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Trappc13 T A 13: 104,144,199 Y399F probably damaging Het
Trim21 T C 7: 102,563,785 D102G probably damaging Het
Trim27 G T 13: 21,180,510 V6L probably benign Het
Trim55 A G 3: 19,674,395 T457A probably benign Het
Trrap A G 5: 144,833,171 E2716G probably benign Het
Usp10 T G 8: 119,956,204 L712R probably damaging Het
Vldlr T A 19: 27,238,792 C338S possibly damaging Het
Zfp946 A G 17: 22,454,699 I145V probably benign Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
PIT4486001:Trank1 UTSW 9 111390107 missense probably damaging 1.00
PIT4812001:Trank1 UTSW 9 111347912 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
R7127:Trank1 UTSW 9 111365796 missense possibly damaging 0.85
R7206:Trank1 UTSW 9 111345515 critical splice donor site probably null
R7236:Trank1 UTSW 9 111373074 missense possibly damaging 0.93
R7247:Trank1 UTSW 9 111367512 missense probably damaging 1.00
R7292:Trank1 UTSW 9 111377870 missense probably benign 0.02
R7310:Trank1 UTSW 9 111367126 missense probably damaging 1.00
R7431:Trank1 UTSW 9 111362402 missense probably benign 0.12
R7448:Trank1 UTSW 9 111366349 missense probably benign 0.01
R7477:Trank1 UTSW 9 111364957 missense probably benign 0.00
R7514:Trank1 UTSW 9 111364756 missense probably damaging 1.00
R7595:Trank1 UTSW 9 111365991 missense probably damaging 1.00
R7637:Trank1 UTSW 9 111365296 missense possibly damaging 0.71
R7648:Trank1 UTSW 9 111391685 missense probably benign
R7737:Trank1 UTSW 9 111366012 nonsense probably null
R7784:Trank1 UTSW 9 111364103 missense probably damaging 1.00
R7884:Trank1 UTSW 9 111392516 missense probably benign
R7912:Trank1 UTSW 9 111391528 missense probably benign 0.04
R7938:Trank1 UTSW 9 111365028 missense probably benign
R7979:Trank1 UTSW 9 111377899 missense probably benign 0.00
R8064:Trank1 UTSW 9 111352076 nonsense probably null
R8100:Trank1 UTSW 9 111392793 missense probably damaging 1.00
R8124:Trank1 UTSW 9 111378927 missense probably benign 0.31
R8198:Trank1 UTSW 9 111390812 missense probably benign 0.09
R8219:Trank1 UTSW 9 111364909 missense probably damaging 1.00
R8223:Trank1 UTSW 9 111365889 missense probably damaging 1.00
R8316:Trank1 UTSW 9 111349302 missense probably benign 0.38
R8347:Trank1 UTSW 9 111367249 missense probably damaging 1.00
R8436:Trank1 UTSW 9 111391382 missense possibly damaging 0.86
R8489:Trank1 UTSW 9 111390275 missense probably benign 0.01
R8682:Trank1 UTSW 9 111365344 missense probably benign 0.01
R8768:Trank1 UTSW 9 111389276 missense probably benign 0.00
R8770:Trank1 UTSW 9 111390824 missense probably benign 0.00
R8829:Trank1 UTSW 9 111347523 missense probably benign
R8838:Trank1 UTSW 9 111364905 missense probably benign 0.03
R8855:Trank1 UTSW 9 111312221 missense unknown
R8929:Trank1 UTSW 9 111378935 missense possibly damaging 0.93
R9047:Trank1 UTSW 9 111362432 missense probably damaging 0.99
R9090:Trank1 UTSW 9 111345479 missense probably damaging 1.00
R9114:Trank1 UTSW 9 111333775 missense probably damaging 1.00
R9133:Trank1 UTSW 9 111391702 missense possibly damaging 0.93
R9177:Trank1 UTSW 9 111392511 missense probably benign 0.00
R9178:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R9271:Trank1 UTSW 9 111345479 missense probably damaging 1.00
R9314:Trank1 UTSW 9 111365981 missense probably damaging 1.00
R9373:Trank1 UTSW 9 111365191 missense probably benign 0.25
R9435:Trank1 UTSW 9 111364822 missense probably benign 0.04
R9501:Trank1 UTSW 9 111347875 missense probably benign 0.00
R9593:Trank1 UTSW 9 111362297 missense probably benign 0.30
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Z1177:Trank1 UTSW 9 111311902 missense unknown
Z1177:Trank1 UTSW 9 111367377 missense possibly damaging 0.83
Z1177:Trank1 UTSW 9 111392870 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CTAGTGGTGTCTCTGTGCATCC -3'
(R):5'- ATCCAGACGCTCTGCTCAATG -3'

Sequencing Primer
(F):5'- TCTCTGTGCATCCGCTGGAG -3'
(R):5'- TGCTCAATGCCCTGCAC -3'
Posted On 2022-04-18