Incidental Mutation 'R9380:Trank1'
ID 709951
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Name tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms LOC235639, C030048J01Rik, A230061D21Rik, Lba1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9380 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 111140807-111224843 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111221738 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2825 (E2825G)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000078626
AA Change: E2825G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: E2825G

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (79/79)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 T G 1: 78,659,602 (GRCm39) C85G possibly damaging Het
Alox12e A T 11: 70,206,994 (GRCm39) probably null Het
Aoc1l2 T C 6: 48,910,064 (GRCm39) I667T probably damaging Het
Asb10 A C 5: 24,739,103 (GRCm39) probably null Het
B3galt9 G A 2: 34,729,029 (GRCm39) C276Y probably damaging Het
Bcl2a1d G A 9: 88,613,935 (GRCm39) probably benign Het
Camsap3 A T 8: 3,653,999 (GRCm39) K556N probably benign Het
Cd300lf T A 11: 115,015,153 (GRCm39) T146S probably benign Het
Chuk C A 19: 44,062,958 (GRCm39) A744S unknown Het
Clint1 A T 11: 45,742,988 (GRCm39) M4L probably benign Het
Cnot4 T C 6: 35,029,865 (GRCm39) I344M possibly damaging Het
Cpne1 T C 2: 155,920,721 (GRCm39) D135G probably benign Het
Csgalnact2 C A 6: 118,105,840 (GRCm39) L159F probably damaging Het
Dnai2 T C 11: 114,635,989 (GRCm39) F325L probably benign Het
Dnal4 G A 15: 79,647,790 (GRCm39) S25L possibly damaging Het
Ep300 T C 15: 81,500,245 (GRCm39) M515T unknown Het
Ewsr1 T C 11: 5,043,730 (GRCm39) Y18C possibly damaging Het
Fam25a T C 14: 34,073,957 (GRCm39) T72A possibly damaging Het
Flii T C 11: 60,606,297 (GRCm39) Y1131C probably benign Het
Foxj1 C T 11: 116,222,547 (GRCm39) A419T possibly damaging Het
Fsd1l A G 4: 53,693,991 (GRCm39) T323A possibly damaging Het
Furin T C 7: 80,041,506 (GRCm39) I551V probably benign Het
Gbp11 A G 5: 105,475,202 (GRCm39) V382A probably benign Het
Gfod1 A C 13: 43,354,320 (GRCm39) D218E probably damaging Het
Glp2r A T 11: 67,637,572 (GRCm39) I153N possibly damaging Het
Gm11214 G T 4: 63,580,850 (GRCm39) P100T possibly damaging Het
Gne A T 4: 44,066,807 (GRCm39) F69I probably benign Het
Hsd3b2 T C 3: 98,619,453 (GRCm39) K164R probably damaging Het
Hspa1b T C 17: 35,177,170 (GRCm39) R272G probably damaging Het
Hydin C A 8: 111,290,504 (GRCm39) T3321N probably benign Het
Impg1 A T 9: 80,289,077 (GRCm39) S327T probably benign Het
Izumo2 T C 7: 44,364,812 (GRCm39) V159A probably benign Het
Kat6b T C 14: 21,678,926 (GRCm39) S430P probably damaging Het
Kcnj9 T A 1: 172,153,447 (GRCm39) T226S probably benign Het
Kl T A 5: 150,912,342 (GRCm39) M697K possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lrrk1 G A 7: 65,928,331 (GRCm39) P1266S probably damaging Het
Med13 A T 11: 86,177,598 (GRCm39) N1499K probably benign Het
Mybbp1a A G 11: 72,333,668 (GRCm39) I182V probably benign Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nin A G 12: 70,074,805 (GRCm39) L1859P Het
Nlrp4e C G 7: 23,020,755 (GRCm39) A414G probably benign Het
Or2y10 A G 11: 49,454,904 (GRCm39) D52G possibly damaging Het
Or4a67 A T 2: 88,598,530 (GRCm39) I43N probably damaging Het
Or4k1 C A 14: 50,377,770 (GRCm39) G109W probably damaging Het
Or8b50 A G 9: 38,518,415 (GRCm39) Y218C probably damaging Het
Osbpl8 T A 10: 111,108,980 (GRCm39) S421T probably damaging Het
Paqr7 A G 4: 134,234,350 (GRCm39) N69S probably damaging Het
Pcare A T 17: 72,056,351 (GRCm39) S1109T possibly damaging Het
Pdgfrb G A 18: 61,197,920 (GRCm39) G231D probably damaging Het
Pip5k1b A G 19: 24,356,417 (GRCm39) Y174H probably damaging Het
Pkd1 T A 17: 24,769,262 (GRCm39) L9Q unknown Het
Psmg4 A T 13: 34,350,080 (GRCm39) T71S probably benign Het
Ptpn23 A G 9: 110,221,581 (GRCm39) I173T possibly damaging Het
Qser1 G A 2: 104,619,691 (GRCm39) Q284* probably null Het
Rcc2 G T 4: 140,429,702 (GRCm39) A79S probably benign Het
Rgl3 G T 9: 21,888,123 (GRCm39) Q464K probably damaging Het
Rhov C A 2: 119,100,604 (GRCm39) R211L probably benign Het
Rp1l1 A G 14: 64,266,475 (GRCm39) D687G probably benign Het
Selenbp2 A G 3: 94,609,654 (GRCm39) I291V probably benign Het
Sh3glb2 A T 2: 30,238,625 (GRCm39) V189E probably damaging Het
Slc46a2 A G 4: 59,913,867 (GRCm39) I352T probably damaging Het
Sucla2 T A 14: 73,828,312 (GRCm39) N306K probably benign Het
Suco A G 1: 161,646,074 (GRCm39) V1209A possibly damaging Het
Tacc2 T A 7: 130,226,771 (GRCm39) L1152Q possibly damaging Het
Tanc1 A T 2: 59,665,796 (GRCm39) K1185M probably damaging Het
Tas2r114 A G 6: 131,666,381 (GRCm39) F216L probably benign Het
Tead1 A T 7: 112,441,105 (GRCm39) H78L possibly damaging Het
Tex12 T C 9: 50,469,586 (GRCm39) I64V possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Trappc13 T A 13: 104,280,707 (GRCm39) Y399F probably damaging Het
Trim21 T C 7: 102,212,992 (GRCm39) D102G probably damaging Het
Trim27 G T 13: 21,364,680 (GRCm39) V6L probably benign Het
Trim55 A G 3: 19,728,559 (GRCm39) T457A probably benign Het
Trrap A G 5: 144,769,981 (GRCm39) E2716G probably benign Het
Usp10 T G 8: 120,682,943 (GRCm39) L712R probably damaging Het
Vldlr T A 19: 27,216,192 (GRCm39) C338S possibly damaging Het
Zfp946 A G 17: 22,673,680 (GRCm39) I145V probably benign Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111,221,677 (GRCm39) missense probably damaging 1.00
IGL00467:Trank1 APN 9 111,193,734 (GRCm39) splice site probably benign
IGL00569:Trank1 APN 9 111,174,579 (GRCm39) missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111,178,358 (GRCm39) missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111,195,861 (GRCm39) missense probably damaging 1.00
IGL01134:Trank1 APN 9 111,220,849 (GRCm39) missense probably benign
IGL01154:Trank1 APN 9 111,215,468 (GRCm39) missense probably benign 0.00
IGL01355:Trank1 APN 9 111,194,588 (GRCm39) missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111,193,790 (GRCm39) missense probably damaging 0.99
IGL01410:Trank1 APN 9 111,194,117 (GRCm39) missense probably benign 0.00
IGL01410:Trank1 APN 9 111,194,327 (GRCm39) missense probably benign 0.00
IGL01504:Trank1 APN 9 111,202,612 (GRCm39) missense probably damaging 1.00
IGL01744:Trank1 APN 9 111,178,431 (GRCm39) missense probably damaging 1.00
IGL02043:Trank1 APN 9 111,193,028 (GRCm39) missense probably damaging 0.98
IGL02104:Trank1 APN 9 111,219,780 (GRCm39) missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111,196,344 (GRCm39) missense probably benign 0.43
IGL02581:Trank1 APN 9 111,212,193 (GRCm39) missense probably benign 0.00
IGL02630:Trank1 APN 9 111,202,143 (GRCm39) missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111,193,824 (GRCm39) missense probably damaging 1.00
IGL02897:Trank1 APN 9 111,196,585 (GRCm39) missense probably damaging 0.99
IGL03065:Trank1 APN 9 111,219,361 (GRCm39) missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111,196,475 (GRCm39) missense probably damaging 1.00
IGL03143:Trank1 APN 9 111,195,155 (GRCm39) missense probably damaging 1.00
IGL03323:Trank1 APN 9 111,181,184 (GRCm39) missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111,222,049 (GRCm39) missense probably damaging 1.00
PIT4486001:Trank1 UTSW 9 111,219,175 (GRCm39) missense probably damaging 1.00
PIT4812001:Trank1 UTSW 9 111,176,980 (GRCm39) missense probably damaging 1.00
R0035:Trank1 UTSW 9 111,195,844 (GRCm39) missense probably benign 0.00
R0064:Trank1 UTSW 9 111,172,263 (GRCm39) missense probably damaging 1.00
R0064:Trank1 UTSW 9 111,172,263 (GRCm39) missense probably damaging 1.00
R0089:Trank1 UTSW 9 111,221,978 (GRCm39) missense probably benign 0.00
R0207:Trank1 UTSW 9 111,195,321 (GRCm39) missense probably damaging 1.00
R0255:Trank1 UTSW 9 111,195,092 (GRCm39) missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111,222,008 (GRCm39) missense probably damaging 1.00
R0334:Trank1 UTSW 9 111,194,421 (GRCm39) missense probably benign 0.00
R0383:Trank1 UTSW 9 111,220,545 (GRCm39) missense probably benign 0.08
R0421:Trank1 UTSW 9 111,220,907 (GRCm39) missense probably damaging 1.00
R0494:Trank1 UTSW 9 111,220,361 (GRCm39) missense probably benign 0.19
R0518:Trank1 UTSW 9 111,162,876 (GRCm39) missense probably damaging 1.00
R0560:Trank1 UTSW 9 111,220,154 (GRCm39) missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111,219,509 (GRCm39) missense probably damaging 1.00
R0731:Trank1 UTSW 9 111,194,556 (GRCm39) missense probably damaging 1.00
R0761:Trank1 UTSW 9 111,195,681 (GRCm39) missense probably damaging 1.00
R0766:Trank1 UTSW 9 111,176,537 (GRCm39) missense probably benign 0.45
R0827:Trank1 UTSW 9 111,178,485 (GRCm39) unclassified probably benign
R1005:Trank1 UTSW 9 111,162,789 (GRCm39) missense probably benign 0.13
R1108:Trank1 UTSW 9 111,194,375 (GRCm39) missense probably benign 0.00
R1155:Trank1 UTSW 9 111,196,038 (GRCm39) missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111,172,300 (GRCm39) missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111,172,300 (GRCm39) missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111,195,358 (GRCm39) missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111,202,545 (GRCm39) missense probably damaging 1.00
R1751:Trank1 UTSW 9 111,220,547 (GRCm39) missense probably benign
R1754:Trank1 UTSW 9 111,221,939 (GRCm39) missense probably benign 0.00
R1767:Trank1 UTSW 9 111,220,547 (GRCm39) missense probably benign
R1768:Trank1 UTSW 9 111,221,995 (GRCm39) missense probably damaging 0.96
R1809:Trank1 UTSW 9 111,221,893 (GRCm39) missense probably benign 0.34
R1912:Trank1 UTSW 9 111,219,777 (GRCm39) missense probably benign 0.00
R1920:Trank1 UTSW 9 111,176,996 (GRCm39) critical splice donor site probably null
R1960:Trank1 UTSW 9 111,220,696 (GRCm39) missense probably damaging 1.00
R1993:Trank1 UTSW 9 111,207,900 (GRCm39) missense probably benign 0.20
R2012:Trank1 UTSW 9 111,194,096 (GRCm39) missense probably benign
R2025:Trank1 UTSW 9 111,221,107 (GRCm39) missense probably benign 0.01
R2050:Trank1 UTSW 9 111,193,856 (GRCm39) missense probably damaging 1.00
R2857:Trank1 UTSW 9 111,196,001 (GRCm39) missense probably benign 0.00
R2912:Trank1 UTSW 9 111,221,551 (GRCm39) missense probably damaging 0.98
R2962:Trank1 UTSW 9 111,181,148 (GRCm39) missense probably damaging 1.00
R3030:Trank1 UTSW 9 111,220,598 (GRCm39) missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111,207,887 (GRCm39) missense probably damaging 1.00
R3822:Trank1 UTSW 9 111,207,887 (GRCm39) missense probably damaging 1.00
R3892:Trank1 UTSW 9 111,193,827 (GRCm39) missense probably benign 0.03
R4105:Trank1 UTSW 9 111,181,265 (GRCm39) missense probably damaging 1.00
R4166:Trank1 UTSW 9 111,202,592 (GRCm39) nonsense probably null
R4237:Trank1 UTSW 9 111,196,103 (GRCm39) missense probably benign 0.04
R4239:Trank1 UTSW 9 111,196,103 (GRCm39) missense probably benign 0.04
R4394:Trank1 UTSW 9 111,194,265 (GRCm39) missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111,195,036 (GRCm39) missense probably benign 0.17
R4611:Trank1 UTSW 9 111,191,329 (GRCm39) missense probably damaging 1.00
R4694:Trank1 UTSW 9 111,221,129 (GRCm39) missense probably benign 0.40
R4731:Trank1 UTSW 9 111,219,478 (GRCm39) missense probably damaging 1.00
R4843:Trank1 UTSW 9 111,195,146 (GRCm39) missense probably benign 0.00
R4852:Trank1 UTSW 9 111,220,963 (GRCm39) missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111,194,078 (GRCm39) missense probably benign 0.17
R4868:Trank1 UTSW 9 111,194,709 (GRCm39) missense probably damaging 1.00
R5080:Trank1 UTSW 9 111,218,289 (GRCm39) missense probably damaging 0.99
R5156:Trank1 UTSW 9 111,219,762 (GRCm39) missense probably damaging 1.00
R5174:Trank1 UTSW 9 111,194,627 (GRCm39) missense probably benign 0.00
R5234:Trank1 UTSW 9 111,215,535 (GRCm39) missense probably damaging 1.00
R5386:Trank1 UTSW 9 111,191,470 (GRCm39) missense probably benign 0.12
R5419:Trank1 UTSW 9 111,220,369 (GRCm39) missense probably damaging 1.00
R5435:Trank1 UTSW 9 111,220,958 (GRCm39) missense probably benign 0.00
R5444:Trank1 UTSW 9 111,222,026 (GRCm39) missense probably benign 0.04
R5543:Trank1 UTSW 9 111,195,180 (GRCm39) missense probably damaging 0.97
R5560:Trank1 UTSW 9 111,219,635 (GRCm39) missense probably damaging 1.00
R5772:Trank1 UTSW 9 111,195,744 (GRCm39) missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111,220,294 (GRCm39) missense probably damaging 1.00
R5843:Trank1 UTSW 9 111,194,928 (GRCm39) missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111,221,604 (GRCm39) missense probably benign
R5878:Trank1 UTSW 9 111,195,753 (GRCm39) missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111,220,784 (GRCm39) missense probably damaging 1.00
R5917:Trank1 UTSW 9 111,191,485 (GRCm39) missense probably benign 0.38
R5954:Trank1 UTSW 9 111,194,201 (GRCm39) missense probably benign 0.13
R6041:Trank1 UTSW 9 111,206,864 (GRCm39) missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111,220,805 (GRCm39) missense probably damaging 1.00
R6165:Trank1 UTSW 9 111,220,940 (GRCm39) missense probably benign 0.00
R6255:Trank1 UTSW 9 111,181,314 (GRCm39) critical splice donor site probably null
R6395:Trank1 UTSW 9 111,196,268 (GRCm39) missense probably damaging 1.00
R6567:Trank1 UTSW 9 111,176,589 (GRCm39) missense probably benign 0.02
R6644:Trank1 UTSW 9 111,193,902 (GRCm39) missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111,194,984 (GRCm39) missense probably damaging 1.00
R6788:Trank1 UTSW 9 111,219,747 (GRCm39) missense probably damaging 1.00
R6831:Trank1 UTSW 9 111,206,967 (GRCm39) missense probably benign 0.00
R6934:Trank1 UTSW 9 111,202,158 (GRCm39) missense probably damaging 0.99
R7127:Trank1 UTSW 9 111,194,864 (GRCm39) missense possibly damaging 0.85
R7206:Trank1 UTSW 9 111,174,583 (GRCm39) critical splice donor site probably null
R7236:Trank1 UTSW 9 111,202,142 (GRCm39) missense possibly damaging 0.93
R7247:Trank1 UTSW 9 111,196,580 (GRCm39) missense probably damaging 1.00
R7292:Trank1 UTSW 9 111,206,938 (GRCm39) missense probably benign 0.02
R7310:Trank1 UTSW 9 111,196,194 (GRCm39) missense probably damaging 1.00
R7431:Trank1 UTSW 9 111,191,470 (GRCm39) missense probably benign 0.12
R7448:Trank1 UTSW 9 111,195,417 (GRCm39) missense probably benign 0.01
R7477:Trank1 UTSW 9 111,194,025 (GRCm39) missense probably benign 0.00
R7514:Trank1 UTSW 9 111,193,824 (GRCm39) missense probably damaging 1.00
R7595:Trank1 UTSW 9 111,195,059 (GRCm39) missense probably damaging 1.00
R7637:Trank1 UTSW 9 111,194,364 (GRCm39) missense possibly damaging 0.71
R7648:Trank1 UTSW 9 111,220,753 (GRCm39) missense probably benign
R7737:Trank1 UTSW 9 111,195,080 (GRCm39) nonsense probably null
R7784:Trank1 UTSW 9 111,193,171 (GRCm39) missense probably damaging 1.00
R7884:Trank1 UTSW 9 111,221,584 (GRCm39) missense probably benign
R7912:Trank1 UTSW 9 111,220,596 (GRCm39) missense probably benign 0.04
R7938:Trank1 UTSW 9 111,194,096 (GRCm39) missense probably benign
R7979:Trank1 UTSW 9 111,206,967 (GRCm39) missense probably benign 0.00
R8064:Trank1 UTSW 9 111,181,144 (GRCm39) nonsense probably null
R8100:Trank1 UTSW 9 111,221,861 (GRCm39) missense probably damaging 1.00
R8124:Trank1 UTSW 9 111,207,995 (GRCm39) missense probably benign 0.31
R8198:Trank1 UTSW 9 111,219,880 (GRCm39) missense probably benign 0.09
R8219:Trank1 UTSW 9 111,193,977 (GRCm39) missense probably damaging 1.00
R8223:Trank1 UTSW 9 111,194,957 (GRCm39) missense probably damaging 1.00
R8316:Trank1 UTSW 9 111,178,370 (GRCm39) missense probably benign 0.38
R8347:Trank1 UTSW 9 111,196,317 (GRCm39) missense probably damaging 1.00
R8436:Trank1 UTSW 9 111,220,450 (GRCm39) missense possibly damaging 0.86
R8489:Trank1 UTSW 9 111,219,343 (GRCm39) missense probably benign 0.01
R8682:Trank1 UTSW 9 111,194,412 (GRCm39) missense probably benign 0.01
R8768:Trank1 UTSW 9 111,218,344 (GRCm39) missense probably benign 0.00
R8770:Trank1 UTSW 9 111,219,892 (GRCm39) missense probably benign 0.00
R8829:Trank1 UTSW 9 111,176,591 (GRCm39) missense probably benign
R8838:Trank1 UTSW 9 111,193,973 (GRCm39) missense probably benign 0.03
R8855:Trank1 UTSW 9 111,141,289 (GRCm39) missense unknown
R8929:Trank1 UTSW 9 111,208,003 (GRCm39) missense possibly damaging 0.93
R9047:Trank1 UTSW 9 111,191,500 (GRCm39) missense probably damaging 0.99
R9090:Trank1 UTSW 9 111,174,547 (GRCm39) missense probably damaging 1.00
R9114:Trank1 UTSW 9 111,162,843 (GRCm39) missense probably damaging 1.00
R9133:Trank1 UTSW 9 111,220,770 (GRCm39) missense possibly damaging 0.93
R9177:Trank1 UTSW 9 111,221,579 (GRCm39) missense probably benign 0.00
R9178:Trank1 UTSW 9 111,196,268 (GRCm39) missense probably damaging 1.00
R9271:Trank1 UTSW 9 111,174,547 (GRCm39) missense probably damaging 1.00
R9314:Trank1 UTSW 9 111,195,049 (GRCm39) missense probably damaging 1.00
R9373:Trank1 UTSW 9 111,194,259 (GRCm39) missense probably benign 0.25
R9435:Trank1 UTSW 9 111,193,890 (GRCm39) missense probably benign 0.04
R9501:Trank1 UTSW 9 111,176,943 (GRCm39) missense probably benign 0.00
R9593:Trank1 UTSW 9 111,191,365 (GRCm39) missense probably benign 0.30
R9601:Trank1 UTSW 9 111,202,193 (GRCm39) missense probably benign 0.18
R9729:Trank1 UTSW 9 111,220,537 (GRCm39) missense probably damaging 1.00
X0064:Trank1 UTSW 9 111,172,304 (GRCm39) missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111,193,778 (GRCm39) missense probably damaging 0.99
Z1177:Trank1 UTSW 9 111,221,938 (GRCm39) missense possibly damaging 0.47
Z1177:Trank1 UTSW 9 111,196,445 (GRCm39) missense possibly damaging 0.83
Z1177:Trank1 UTSW 9 111,140,970 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CTAGTGGTGTCTCTGTGCATCC -3'
(R):5'- ATCCAGACGCTCTGCTCAATG -3'

Sequencing Primer
(F):5'- TCTCTGTGCATCCGCTGGAG -3'
(R):5'- TGCTCAATGCCCTGCAC -3'
Posted On 2022-04-18