Incidental Mutation 'R9381:Atg9a'
ID 709988
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Name autophagy related 9A
Synonyms Apg9l1
MMRRC Submission 068992-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9381 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 75157509-75168654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75162726 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 430 (M430L)
Ref Sequence ENSEMBL: ENSMUSP00000047449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040689] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189665] [ENSMUST00000189702]
AlphaFold Q68FE2
Predicted Effect probably benign
Transcript: ENSMUST00000040689
AA Change: M430L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: M430L

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect probably benign
Transcript: ENSMUST00000187785
Predicted Effect probably benign
Transcript: ENSMUST00000188347
AA Change: M430L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: M430L

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189702
AA Change: M430L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: M430L

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
9930111J21Rik1 T A 11: 48,839,204 (GRCm39) K461M probably damaging Het
Abhd16b A G 2: 181,135,881 (GRCm39) Y261C probably damaging Het
Acadl T C 1: 66,893,805 (GRCm39) T117A probably benign Het
Adamts15 A G 9: 30,813,816 (GRCm39) V783A probably damaging Het
Aff1 A T 5: 103,981,733 (GRCm39) Q624L possibly damaging Het
Afg3l2 T G 18: 67,575,451 (GRCm39) E74A probably damaging Het
Aig1 T C 10: 13,523,417 (GRCm39) E238G probably benign Het
Ankrd17 C T 5: 90,416,508 (GRCm39) R1108Q probably damaging Het
Anks1 A T 17: 28,272,979 (GRCm39) Y958F probably damaging Het
Arhgef28 C A 13: 98,036,269 (GRCm39) Q1663H possibly damaging Het
Asb3 T C 11: 31,051,088 (GRCm39) L475P probably damaging Het
Bco1 T A 8: 117,837,631 (GRCm39) V164E probably benign Het
Bhlhe40 T C 6: 108,642,244 (GRCm39) L396P probably damaging Het
C5ar2 A T 7: 15,970,887 (GRCm39) S347T probably damaging Het
Cdc42bpa T C 1: 179,969,048 (GRCm39) S1212P probably damaging Het
Ceacam3 C G 7: 16,893,715 (GRCm39) Q409E Het
Ces3b T C 8: 105,811,670 (GRCm39) V62A probably benign Het
Dalrd3 A G 9: 108,448,242 (GRCm39) probably null Het
Ddhd2 G T 8: 26,239,849 (GRCm39) A288E probably benign Het
Dnah17 T A 11: 117,914,219 (GRCm39) M4435L probably benign Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
E030025P04Rik A G 11: 109,030,384 (GRCm39) Y168H unknown Het
Elavl2 T C 4: 91,197,009 (GRCm39) N23S probably benign Het
Elfn1 T C 5: 139,959,462 (GRCm39) V822A probably damaging Het
Emb G T 13: 117,357,096 (GRCm39) probably benign Het
Exoc5 C T 14: 49,275,194 (GRCm39) S202N probably benign Het
Fryl T C 5: 73,240,637 (GRCm39) D1321G probably benign Het
Gm12258 C T 11: 58,750,007 (GRCm39) T394I unknown Het
Gm28363 T A 1: 117,654,615 (GRCm39) S85T probably damaging Het
H2-Q1 A G 17: 35,542,138 (GRCm39) T237A probably damaging Het
Hectd4 A T 5: 121,472,492 (GRCm39) I2743F possibly damaging Het
Hs3st3b1 C T 11: 63,812,692 (GRCm39) G8S probably benign Het
Ighv1-16 T C 12: 114,629,598 (GRCm39) N63S probably benign Het
Il20rb A G 9: 100,343,541 (GRCm39) F238L possibly damaging Het
Il31ra A T 13: 112,668,253 (GRCm39) F439I possibly damaging Het
Jup C T 11: 100,270,391 (GRCm39) C372Y probably damaging Het
Kat2a T C 11: 100,602,692 (GRCm39) Q132R possibly damaging Het
Kcnq2 A G 2: 180,751,562 (GRCm39) I278T probably damaging Het
Lama1 T C 17: 68,044,479 (GRCm39) V126A Het
Lama2 T A 10: 27,064,023 (GRCm39) R1285* probably null Het
Larp1 A G 11: 57,949,532 (GRCm39) T1054A probably benign Het
Lrp1 A T 10: 127,441,337 (GRCm39) M262K probably benign Het
Lrrd1 A G 5: 3,901,074 (GRCm39) I460V probably benign Het
Ltbp1 A T 17: 75,696,434 (GRCm39) N1606I probably damaging Het
Mdga2 T C 12: 66,597,304 (GRCm39) N730S possibly damaging Het
Mpzl1 T C 1: 165,429,323 (GRCm39) H236R probably damaging Het
Mrps31 G A 8: 22,904,752 (GRCm39) R47K probably damaging Het
Nae1 A T 8: 105,250,239 (GRCm39) I218K probably benign Het
Npy2r T C 3: 82,448,356 (GRCm39) T140A probably damaging Het
Nr2e1 T A 10: 42,439,468 (GRCm39) L350F probably damaging Het
Nup210l C T 3: 90,107,173 (GRCm39) P1570L probably benign Het
Or51d1 A T 7: 102,347,654 (GRCm39) M70L probably damaging Het
Or5b124 G T 19: 13,610,647 (GRCm39) M57I probably damaging Het
Or5p50 A C 7: 107,421,812 (GRCm39) L288W probably damaging Het
Pabpc1l G T 2: 163,867,423 (GRCm39) C8F probably benign Het
Pafah1b3 A C 7: 24,994,699 (GRCm39) F172V probably benign Het
Pcdhga6 A T 18: 37,841,371 (GRCm39) T364S probably damaging Het
Ppp3cc T A 14: 70,462,441 (GRCm39) M399L probably benign Het
Prpsap2 T C 11: 61,635,782 (GRCm39) I173V probably benign Het
Rabggtb A T 3: 153,613,817 (GRCm39) W252R probably damaging Het
Raph1 A G 1: 60,540,959 (GRCm39) F351L unknown Het
Rasd2 T C 8: 75,948,589 (GRCm39) S172P probably damaging Het
Rbm15 T C 3: 107,238,752 (GRCm39) T549A probably benign Het
Reln A G 5: 22,549,202 (GRCm39) Y69H possibly damaging Het
Samd3 T A 10: 26,147,643 (GRCm39) N439K probably benign Het
Scap C A 9: 110,207,839 (GRCm39) A516D probably damaging Het
Selplg T C 5: 113,957,917 (GRCm39) T130A probably benign Het
Slc12a7 A G 13: 73,949,063 (GRCm39) M697V probably benign Het
Slc22a29 A G 19: 8,195,841 (GRCm39) I66T probably benign Het
Slco1a7 T C 6: 141,711,490 (GRCm39) I74V probably benign Het
Snrnp48 A C 13: 38,404,667 (GRCm39) I241L probably damaging Het
Sptb C T 12: 76,634,292 (GRCm39) E2140K probably benign Het
Strip2 T C 6: 29,927,333 (GRCm39) S192P probably benign Het
Svil A T 18: 5,099,013 (GRCm39) R1643S probably benign Het
Tbc1d2b A G 9: 90,101,139 (GRCm39) V617A possibly damaging Het
Tmem102 T C 11: 69,695,141 (GRCm39) E277G probably benign Het
Tmtc4 T G 14: 123,163,441 (GRCm39) I648L probably benign Het
Togaram1 T C 12: 65,014,204 (GRCm39) V485A probably damaging Het
Trim43b T C 9: 88,969,642 (GRCm39) I269V probably benign Het
Trpm2 T A 10: 77,747,191 (GRCm39) I1436F possibly damaging Het
Ube2d3 A T 3: 135,168,722 (GRCm39) I106F possibly damaging Het
Vdr G A 15: 97,755,333 (GRCm39) R397C probably damaging Het
Vps50 T C 6: 3,592,433 (GRCm39) S689P probably benign Het
Wipf2 A G 11: 98,787,068 (GRCm39) T366A probably damaging Het
Zfp128 T C 7: 12,624,897 (GRCm39) Y422H possibly damaging Het
Zfyve28 G A 5: 34,373,932 (GRCm39) T694I probably benign Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75,167,010 (GRCm39) missense probably damaging 1.00
IGL02041:Atg9a APN 1 75,159,748 (GRCm39) missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75,164,601 (GRCm39) missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75,164,597 (GRCm39) nonsense probably null
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0408:Atg9a UTSW 1 75,161,939 (GRCm39) missense probably damaging 1.00
R0520:Atg9a UTSW 1 75,163,178 (GRCm39) nonsense probably null
R0653:Atg9a UTSW 1 75,166,972 (GRCm39) missense probably damaging 0.96
R0666:Atg9a UTSW 1 75,161,734 (GRCm39) missense probably damaging 0.99
R0961:Atg9a UTSW 1 75,163,390 (GRCm39) missense probably damaging 0.99
R1489:Atg9a UTSW 1 75,162,734 (GRCm39) missense probably damaging 1.00
R1490:Atg9a UTSW 1 75,162,389 (GRCm39) missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75,166,999 (GRCm39) missense probably benign 0.04
R1997:Atg9a UTSW 1 75,166,270 (GRCm39) missense probably benign 0.33
R2005:Atg9a UTSW 1 75,162,635 (GRCm39) missense probably benign 0.18
R2172:Atg9a UTSW 1 75,162,329 (GRCm39) missense probably damaging 0.99
R4004:Atg9a UTSW 1 75,163,095 (GRCm39) missense probably damaging 1.00
R4105:Atg9a UTSW 1 75,162,603 (GRCm39) missense probably damaging 1.00
R5010:Atg9a UTSW 1 75,162,704 (GRCm39) splice site probably null
R5220:Atg9a UTSW 1 75,162,372 (GRCm39) missense probably damaging 1.00
R5898:Atg9a UTSW 1 75,162,916 (GRCm39) missense probably damaging 1.00
R6295:Atg9a UTSW 1 75,161,702 (GRCm39) missense probably benign 0.01
R6390:Atg9a UTSW 1 75,164,625 (GRCm39) missense probably damaging 1.00
R7312:Atg9a UTSW 1 75,164,736 (GRCm39) missense probably damaging 1.00
R7729:Atg9a UTSW 1 75,161,204 (GRCm39) missense probably benign 0.34
R8111:Atg9a UTSW 1 75,164,366 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,163,009 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,161,927 (GRCm39) missense probably damaging 1.00
R8256:Atg9a UTSW 1 75,163,563 (GRCm39) missense possibly damaging 0.88
R8319:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8321:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8382:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8406:Atg9a UTSW 1 75,167,028 (GRCm39) missense probably damaging 1.00
R8482:Atg9a UTSW 1 75,162,870 (GRCm39) missense probably damaging 0.99
R8855:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R8866:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R9441:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9442:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9448:Atg9a UTSW 1 75,162,849 (GRCm39) missense probably benign 0.35
R9608:Atg9a UTSW 1 75,161,739 (GRCm39) missense possibly damaging 0.52
R9703:Atg9a UTSW 1 75,162,431 (GRCm39) missense probably damaging 0.98
RF021:Atg9a UTSW 1 75,159,273 (GRCm39) missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75,163,203 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTCTAGCAGGCCCTAAC -3'
(R):5'- AATGGTGCCTTCTTCGCTG -3'

Sequencing Primer
(F):5'- TCTCTAGCAGGCCCTAACTCCAG -3'
(R):5'- CCCTCACCATCTATGATGAAGATGTG -3'
Posted On 2022-04-18