Incidental Mutation 'R9381:Nup210l'
ID 709996
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik
MMRRC Submission 068992-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R9381 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 90011439-90119355 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 90107173 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 1570 (P1570L)
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably benign
Transcript: ENSMUST00000029548
AA Change: P1570L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: P1570L

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200410
AA Change: P1570L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: P1570L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
9930111J21Rik1 T A 11: 48,839,204 (GRCm39) K461M probably damaging Het
Abhd16b A G 2: 181,135,881 (GRCm39) Y261C probably damaging Het
Acadl T C 1: 66,893,805 (GRCm39) T117A probably benign Het
Adamts15 A G 9: 30,813,816 (GRCm39) V783A probably damaging Het
Aff1 A T 5: 103,981,733 (GRCm39) Q624L possibly damaging Het
Afg3l2 T G 18: 67,575,451 (GRCm39) E74A probably damaging Het
Aig1 T C 10: 13,523,417 (GRCm39) E238G probably benign Het
Ankrd17 C T 5: 90,416,508 (GRCm39) R1108Q probably damaging Het
Anks1 A T 17: 28,272,979 (GRCm39) Y958F probably damaging Het
Arhgef28 C A 13: 98,036,269 (GRCm39) Q1663H possibly damaging Het
Asb3 T C 11: 31,051,088 (GRCm39) L475P probably damaging Het
Atg9a T A 1: 75,162,726 (GRCm39) M430L probably benign Het
Bco1 T A 8: 117,837,631 (GRCm39) V164E probably benign Het
Bhlhe40 T C 6: 108,642,244 (GRCm39) L396P probably damaging Het
C5ar2 A T 7: 15,970,887 (GRCm39) S347T probably damaging Het
Cdc42bpa T C 1: 179,969,048 (GRCm39) S1212P probably damaging Het
Ceacam3 C G 7: 16,893,715 (GRCm39) Q409E Het
Ces3b T C 8: 105,811,670 (GRCm39) V62A probably benign Het
Dalrd3 A G 9: 108,448,242 (GRCm39) probably null Het
Ddhd2 G T 8: 26,239,849 (GRCm39) A288E probably benign Het
Dnah17 T A 11: 117,914,219 (GRCm39) M4435L probably benign Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
E030025P04Rik A G 11: 109,030,384 (GRCm39) Y168H unknown Het
Elavl2 T C 4: 91,197,009 (GRCm39) N23S probably benign Het
Elfn1 T C 5: 139,959,462 (GRCm39) V822A probably damaging Het
Emb G T 13: 117,357,096 (GRCm39) probably benign Het
Exoc5 C T 14: 49,275,194 (GRCm39) S202N probably benign Het
Fryl T C 5: 73,240,637 (GRCm39) D1321G probably benign Het
Gm12258 C T 11: 58,750,007 (GRCm39) T394I unknown Het
Gm28363 T A 1: 117,654,615 (GRCm39) S85T probably damaging Het
H2-Q1 A G 17: 35,542,138 (GRCm39) T237A probably damaging Het
Hectd4 A T 5: 121,472,492 (GRCm39) I2743F possibly damaging Het
Hs3st3b1 C T 11: 63,812,692 (GRCm39) G8S probably benign Het
Ighv1-16 T C 12: 114,629,598 (GRCm39) N63S probably benign Het
Il20rb A G 9: 100,343,541 (GRCm39) F238L possibly damaging Het
Il31ra A T 13: 112,668,253 (GRCm39) F439I possibly damaging Het
Jup C T 11: 100,270,391 (GRCm39) C372Y probably damaging Het
Kat2a T C 11: 100,602,692 (GRCm39) Q132R possibly damaging Het
Kcnq2 A G 2: 180,751,562 (GRCm39) I278T probably damaging Het
Lama1 T C 17: 68,044,479 (GRCm39) V126A Het
Lama2 T A 10: 27,064,023 (GRCm39) R1285* probably null Het
Larp1 A G 11: 57,949,532 (GRCm39) T1054A probably benign Het
Lrp1 A T 10: 127,441,337 (GRCm39) M262K probably benign Het
Lrrd1 A G 5: 3,901,074 (GRCm39) I460V probably benign Het
Ltbp1 A T 17: 75,696,434 (GRCm39) N1606I probably damaging Het
Mdga2 T C 12: 66,597,304 (GRCm39) N730S possibly damaging Het
Mpzl1 T C 1: 165,429,323 (GRCm39) H236R probably damaging Het
Mrps31 G A 8: 22,904,752 (GRCm39) R47K probably damaging Het
Nae1 A T 8: 105,250,239 (GRCm39) I218K probably benign Het
Npy2r T C 3: 82,448,356 (GRCm39) T140A probably damaging Het
Nr2e1 T A 10: 42,439,468 (GRCm39) L350F probably damaging Het
Or51d1 A T 7: 102,347,654 (GRCm39) M70L probably damaging Het
Or5b124 G T 19: 13,610,647 (GRCm39) M57I probably damaging Het
Or5p50 A C 7: 107,421,812 (GRCm39) L288W probably damaging Het
Pabpc1l G T 2: 163,867,423 (GRCm39) C8F probably benign Het
Pafah1b3 A C 7: 24,994,699 (GRCm39) F172V probably benign Het
Pcdhga6 A T 18: 37,841,371 (GRCm39) T364S probably damaging Het
Ppp3cc T A 14: 70,462,441 (GRCm39) M399L probably benign Het
Prpsap2 T C 11: 61,635,782 (GRCm39) I173V probably benign Het
Rabggtb A T 3: 153,613,817 (GRCm39) W252R probably damaging Het
Raph1 A G 1: 60,540,959 (GRCm39) F351L unknown Het
Rasd2 T C 8: 75,948,589 (GRCm39) S172P probably damaging Het
Rbm15 T C 3: 107,238,752 (GRCm39) T549A probably benign Het
Reln A G 5: 22,549,202 (GRCm39) Y69H possibly damaging Het
Samd3 T A 10: 26,147,643 (GRCm39) N439K probably benign Het
Scap C A 9: 110,207,839 (GRCm39) A516D probably damaging Het
Selplg T C 5: 113,957,917 (GRCm39) T130A probably benign Het
Slc12a7 A G 13: 73,949,063 (GRCm39) M697V probably benign Het
Slc22a29 A G 19: 8,195,841 (GRCm39) I66T probably benign Het
Slco1a7 T C 6: 141,711,490 (GRCm39) I74V probably benign Het
Snrnp48 A C 13: 38,404,667 (GRCm39) I241L probably damaging Het
Sptb C T 12: 76,634,292 (GRCm39) E2140K probably benign Het
Strip2 T C 6: 29,927,333 (GRCm39) S192P probably benign Het
Svil A T 18: 5,099,013 (GRCm39) R1643S probably benign Het
Tbc1d2b A G 9: 90,101,139 (GRCm39) V617A possibly damaging Het
Tmem102 T C 11: 69,695,141 (GRCm39) E277G probably benign Het
Tmtc4 T G 14: 123,163,441 (GRCm39) I648L probably benign Het
Togaram1 T C 12: 65,014,204 (GRCm39) V485A probably damaging Het
Trim43b T C 9: 88,969,642 (GRCm39) I269V probably benign Het
Trpm2 T A 10: 77,747,191 (GRCm39) I1436F possibly damaging Het
Ube2d3 A T 3: 135,168,722 (GRCm39) I106F possibly damaging Het
Vdr G A 15: 97,755,333 (GRCm39) R397C probably damaging Het
Vps50 T C 6: 3,592,433 (GRCm39) S689P probably benign Het
Wipf2 A G 11: 98,787,068 (GRCm39) T366A probably damaging Het
Zfp128 T C 7: 12,624,897 (GRCm39) Y422H possibly damaging Het
Zfyve28 G A 5: 34,373,932 (GRCm39) T694I probably benign Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90,098,156 (GRCm39) splice site probably benign
IGL00813:Nup210l APN 3 90,039,725 (GRCm39) missense probably benign 0.00
IGL01375:Nup210l APN 3 90,067,200 (GRCm39) missense probably damaging 0.96
IGL01731:Nup210l APN 3 90,061,873 (GRCm39) missense probably damaging 1.00
IGL01786:Nup210l APN 3 90,030,083 (GRCm39) nonsense probably null
IGL01958:Nup210l APN 3 90,111,231 (GRCm39) missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90,087,520 (GRCm39) critical splice donor site probably null
IGL02120:Nup210l APN 3 90,044,169 (GRCm39) missense probably damaging 1.00
IGL02313:Nup210l APN 3 90,030,099 (GRCm39) missense probably damaging 1.00
IGL02336:Nup210l APN 3 90,088,859 (GRCm39) critical splice donor site probably null
IGL02348:Nup210l APN 3 90,011,471 (GRCm39) utr 5 prime probably benign
IGL02372:Nup210l APN 3 90,109,278 (GRCm39) missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90,031,537 (GRCm39) missense probably damaging 1.00
IGL02559:Nup210l APN 3 90,067,260 (GRCm39) missense probably benign 0.02
IGL02738:Nup210l APN 3 90,044,157 (GRCm39) missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90,096,852 (GRCm39) missense probably damaging 1.00
IGL03257:Nup210l APN 3 90,087,455 (GRCm39) critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90,077,351 (GRCm39) missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90,098,194 (GRCm39) missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R0040:Nup210l UTSW 3 90,089,212 (GRCm39) missense probably damaging 1.00
R0083:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0090:Nup210l UTSW 3 90,119,086 (GRCm39) missense probably benign 0.00
R0108:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0142:Nup210l UTSW 3 90,079,420 (GRCm39) missense probably damaging 1.00
R0306:Nup210l UTSW 3 90,114,675 (GRCm39) missense probably benign 0.13
R0332:Nup210l UTSW 3 90,039,616 (GRCm39) splice site probably benign
R0346:Nup210l UTSW 3 90,096,745 (GRCm39) missense probably damaging 1.00
R0463:Nup210l UTSW 3 90,087,518 (GRCm39) missense probably null 1.00
R0622:Nup210l UTSW 3 90,075,047 (GRCm39) missense probably damaging 0.98
R0765:Nup210l UTSW 3 90,027,184 (GRCm39) missense probably damaging 0.99
R0990:Nup210l UTSW 3 90,119,232 (GRCm39) missense probably benign 0.00
R1014:Nup210l UTSW 3 90,077,355 (GRCm39) missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90,100,247 (GRCm39) splice site probably benign
R1177:Nup210l UTSW 3 90,109,310 (GRCm39) missense probably benign 0.11
R1183:Nup210l UTSW 3 90,067,252 (GRCm39) missense probably benign 0.04
R1188:Nup210l UTSW 3 90,105,486 (GRCm39) missense probably benign 0.16
R1457:Nup210l UTSW 3 90,098,279 (GRCm39) missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90,077,869 (GRCm39) missense probably benign
R1627:Nup210l UTSW 3 90,051,476 (GRCm39) missense probably benign 0.15
R1778:Nup210l UTSW 3 90,096,793 (GRCm39) missense probably damaging 0.99
R1827:Nup210l UTSW 3 90,061,864 (GRCm39) missense probably damaging 1.00
R1843:Nup210l UTSW 3 90,079,393 (GRCm39) missense probably damaging 0.96
R1858:Nup210l UTSW 3 90,061,806 (GRCm39) missense probably damaging 0.97
R1942:Nup210l UTSW 3 90,058,544 (GRCm39) missense probably benign 0.01
R2015:Nup210l UTSW 3 90,092,739 (GRCm39) missense probably damaging 1.00
R2113:Nup210l UTSW 3 90,098,281 (GRCm39) missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90,088,852 (GRCm39) missense probably damaging 1.00
R3736:Nup210l UTSW 3 90,027,320 (GRCm39) missense probably damaging 1.00
R3740:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3741:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3742:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3771:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3773:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3879:Nup210l UTSW 3 90,092,780 (GRCm39) missense probably damaging 1.00
R3882:Nup210l UTSW 3 90,031,517 (GRCm39) missense probably benign 0.19
R3953:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R4290:Nup210l UTSW 3 90,114,633 (GRCm39) missense probably benign 0.00
R4328:Nup210l UTSW 3 90,083,142 (GRCm39) splice site probably null
R4629:Nup210l UTSW 3 90,098,181 (GRCm39) nonsense probably null
R4629:Nup210l UTSW 3 90,075,182 (GRCm39) missense probably benign 0.21
R4897:Nup210l UTSW 3 90,100,378 (GRCm39) missense probably damaging 1.00
R4906:Nup210l UTSW 3 90,077,337 (GRCm39) missense probably benign 0.06
R4966:Nup210l UTSW 3 90,014,208 (GRCm39) missense probably benign 0.00
R5004:Nup210l UTSW 3 90,087,472 (GRCm39) nonsense probably null
R5237:Nup210l UTSW 3 90,087,505 (GRCm39) missense probably benign 0.00
R5499:Nup210l UTSW 3 90,081,677 (GRCm39) missense probably damaging 1.00
R5522:Nup210l UTSW 3 90,061,972 (GRCm39) missense probably benign 0.10
R5627:Nup210l UTSW 3 90,051,557 (GRCm39) missense probably damaging 0.97
R5678:Nup210l UTSW 3 90,098,266 (GRCm39) missense probably damaging 0.99
R5726:Nup210l UTSW 3 90,036,514 (GRCm39) splice site probably null
R5792:Nup210l UTSW 3 90,107,164 (GRCm39) missense probably damaging 1.00
R6129:Nup210l UTSW 3 90,011,483 (GRCm39) missense probably benign 0.00
R6272:Nup210l UTSW 3 90,077,331 (GRCm39) missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90,027,216 (GRCm39) nonsense probably null
R6293:Nup210l UTSW 3 90,022,371 (GRCm39) missense probably damaging 1.00
R6446:Nup210l UTSW 3 90,079,375 (GRCm39) missense probably damaging 1.00
R6698:Nup210l UTSW 3 90,089,815 (GRCm39) missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90,044,231 (GRCm39) missense probably benign 0.01
R6895:Nup210l UTSW 3 90,067,231 (GRCm39) missense probably damaging 0.97
R6899:Nup210l UTSW 3 90,075,204 (GRCm39) missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90,061,873 (GRCm39) missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90,027,234 (GRCm39) missense probably benign 0.04
R7038:Nup210l UTSW 3 90,067,254 (GRCm39) missense probably damaging 1.00
R7273:Nup210l UTSW 3 90,025,854 (GRCm39) missense probably benign 0.04
R7450:Nup210l UTSW 3 90,022,495 (GRCm39) critical splice donor site probably null
R7514:Nup210l UTSW 3 90,117,766 (GRCm39) critical splice donor site probably null
R7658:Nup210l UTSW 3 90,119,300 (GRCm39) missense probably benign 0.43
R7735:Nup210l UTSW 3 90,092,883 (GRCm39) missense probably damaging 1.00
R7772:Nup210l UTSW 3 90,067,233 (GRCm39) missense probably damaging 1.00
R7800:Nup210l UTSW 3 90,041,904 (GRCm39) missense probably damaging 1.00
R7840:Nup210l UTSW 3 90,030,036 (GRCm39) missense probably benign 0.08
R7847:Nup210l UTSW 3 90,058,430 (GRCm39) missense probably benign
R7848:Nup210l UTSW 3 90,111,212 (GRCm39) missense probably benign 0.01
R8084:Nup210l UTSW 3 90,043,365 (GRCm39) missense probably benign 0.15
R8121:Nup210l UTSW 3 90,022,428 (GRCm39) missense probably damaging 1.00
R8421:Nup210l UTSW 3 90,111,174 (GRCm39) missense probably damaging 1.00
R8458:Nup210l UTSW 3 90,092,874 (GRCm39) missense probably null 1.00
R8701:Nup210l UTSW 3 90,030,121 (GRCm39) missense probably benign 0.41
R8720:Nup210l UTSW 3 90,117,681 (GRCm39) missense probably benign 0.00
R8770:Nup210l UTSW 3 90,025,850 (GRCm39) missense probably damaging 1.00
R8896:Nup210l UTSW 3 90,025,932 (GRCm39) missense probably damaging 1.00
R9033:Nup210l UTSW 3 90,105,396 (GRCm39) missense probably benign
R9371:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9373:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9426:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9427:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9501:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9523:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9574:Nup210l UTSW 3 90,117,693 (GRCm39) missense probably benign
R9612:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9654:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,105,402 (GRCm39) missense probably benign 0.30
R9662:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9682:Nup210l UTSW 3 90,051,469 (GRCm39) missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9750:Nup210l UTSW 3 90,117,659 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCATGCACCCACATTCC -3'
(R):5'- AGGTATTTACTACTAAGCATAGCCA -3'

Sequencing Primer
(F):5'- CTGAGGACAGCTACAGTGTACTTAC -3'
(R):5'- CTGTGGAGAAACTCCTTACC -3'
Posted On 2022-04-18