Incidental Mutation 'R9381:Fryl'
ID 710004
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene Name FRY like transcription coactivator
Synonyms 2510002A14Rik, 2310004H21Rik, 9030227G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.731) question?
Stock # R9381 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 73019987-73256619 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73083294 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1321 (D1321G)
Ref Sequence ENSEMBL: ENSMUSP00000092289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094700
AA Change: D1321G

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: D1321G

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101127
AA Change: D1321G

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: D1321G

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
9930111J21Rik1 T A 11: 48,948,377 K461M probably damaging Het
Abhd16b A G 2: 181,494,088 Y261C probably damaging Het
Acadl T C 1: 66,854,646 T117A probably benign Het
Adamts15 A G 9: 30,902,520 V783A probably damaging Het
Aff1 A T 5: 103,833,867 Q624L possibly damaging Het
Afg3l2 T G 18: 67,442,381 E74A probably damaging Het
Aig1 T C 10: 13,647,673 E238G probably benign Het
Ankrd17 C T 5: 90,268,649 R1108Q probably damaging Het
Anks1 A T 17: 28,054,005 Y958F probably damaging Het
Arhgef28 C A 13: 97,899,761 Q1663H possibly damaging Het
Asb3 T C 11: 31,101,088 L475P probably damaging Het
Atg9a T A 1: 75,186,082 M430L probably benign Het
Bco1 T A 8: 117,110,892 V164E probably benign Het
Bhlhe40 T C 6: 108,665,283 L396P probably damaging Het
C5ar2 A T 7: 16,236,962 S347T probably damaging Het
Cdc42bpa T C 1: 180,141,483 S1212P probably damaging Het
Ceacam3 C G 7: 17,159,790 Q409E Het
Ces3b T C 8: 105,085,038 V62A probably benign Het
Dalrd3 A G 9: 108,571,043 probably null Het
Ddhd2 G T 8: 25,749,822 A288E probably benign Het
Dnah17 T A 11: 118,023,393 M4435L probably benign Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
E030025P04Rik A G 11: 109,139,558 Y168H unknown Het
Elavl2 T C 4: 91,308,772 N23S probably benign Het
Elfn1 T C 5: 139,973,707 V822A probably damaging Het
Emb G T 13: 117,220,560 probably benign Het
Exoc5 C T 14: 49,037,737 S202N probably benign Het
Gm12258 C T 11: 58,859,181 T394I unknown Het
Gm28363 T A 1: 117,726,885 S85T probably damaging Het
Gm5724 T C 6: 141,765,764 I74V probably benign Het
H2-Q1 A G 17: 35,323,162 T237A probably damaging Het
Hectd4 A T 5: 121,334,429 I2743F possibly damaging Het
Hs3st3b1 C T 11: 63,921,866 G8S probably benign Het
Ighv1-16 T C 12: 114,665,978 N63S probably benign Het
Il20rb A G 9: 100,461,488 F238L possibly damaging Het
Il31ra A T 13: 112,531,719 F439I possibly damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kat2a T C 11: 100,711,866 Q132R possibly damaging Het
Kcnq2 A G 2: 181,109,769 I278T probably damaging Het
Lama1 T C 17: 67,737,484 V126A Het
Lama2 T A 10: 27,188,027 R1285* probably null Het
Larp1 A G 11: 58,058,706 T1054A probably benign Het
Lrp1 A T 10: 127,605,468 M262K probably benign Het
Lrrd1 A G 5: 3,851,074 I460V probably benign Het
Ltbp1 A T 17: 75,389,439 N1606I probably damaging Het
Mdga2 T C 12: 66,550,530 N730S possibly damaging Het
Mpzl1 T C 1: 165,601,754 H236R probably damaging Het
Mrps31 G A 8: 22,414,736 R47K probably damaging Het
Nae1 A T 8: 104,523,607 I218K probably benign Het
Npy2r T C 3: 82,541,049 T140A probably damaging Het
Nr2e1 T A 10: 42,563,472 L350F probably damaging Het
Nup210l C T 3: 90,199,866 P1570L probably benign Het
Olfr1489 G T 19: 13,633,283 M57I probably damaging Het
Olfr469 A C 7: 107,822,605 L288W probably damaging Het
Olfr557 A T 7: 102,698,447 M70L probably damaging Het
Pabpc1l G T 2: 164,025,503 C8F probably benign Het
Pafah1b3 A C 7: 25,295,274 F172V probably benign Het
Pcdhga6 A T 18: 37,708,318 T364S probably damaging Het
Ppp3cc T A 14: 70,224,992 M399L probably benign Het
Prpsap2 T C 11: 61,744,956 I173V probably benign Het
Rabggtb A T 3: 153,908,180 W252R probably damaging Het
Raph1 A G 1: 60,501,800 F351L unknown Het
Rasd2 T C 8: 75,221,961 S172P probably damaging Het
Rbm15 T C 3: 107,331,436 T549A probably benign Het
Reln A G 5: 22,344,204 Y69H possibly damaging Het
Samd3 T A 10: 26,271,745 N439K probably benign Het
Scap C A 9: 110,378,771 A516D probably damaging Het
Selplg T C 5: 113,819,856 T130A probably benign Het
Slc12a7 A G 13: 73,800,944 M697V probably benign Het
Slc22a29 A G 19: 8,218,477 I66T probably benign Het
Snrnp48 A C 13: 38,220,691 I241L probably damaging Het
Sptb C T 12: 76,587,518 E2140K probably benign Het
Strip2 T C 6: 29,927,334 S192P probably benign Het
Svil A T 18: 5,099,013 R1643S probably benign Het
Tbc1d2b A G 9: 90,219,086 V617A possibly damaging Het
Tmem102 T C 11: 69,804,315 E277G probably benign Het
Tmtc4 T G 14: 122,926,029 I648L probably benign Het
Togaram1 T C 12: 64,967,430 V485A probably damaging Het
Trim43b T C 9: 89,087,589 I269V probably benign Het
Trpm2 T A 10: 77,911,357 I1436F possibly damaging Het
Ube2d3 A T 3: 135,462,961 I106F possibly damaging Het
Vdr G A 15: 97,857,452 R397C probably damaging Het
Vps50 T C 6: 3,592,433 S689P probably benign Het
Wipf2 A G 11: 98,896,242 T366A probably damaging Het
Zfp128 T C 7: 12,890,970 Y422H possibly damaging Het
Zfyve28 G A 5: 34,216,588 T694I probably benign Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73148108 missense possibly damaging 0.92
IGL01518:Fryl APN 5 73086962 missense possibly damaging 0.76
IGL01545:Fryl APN 5 73054597 missense probably damaging 1.00
IGL01646:Fryl APN 5 73022501 critical splice donor site probably null
IGL01938:Fryl APN 5 73122364 missense probably damaging 0.98
IGL01962:Fryl APN 5 73032791 missense possibly damaging 0.62
IGL02064:Fryl APN 5 73124769 unclassified probably benign
IGL02148:Fryl APN 5 73075959 missense probably benign 0.35
IGL02418:Fryl APN 5 73110176 splice site probably benign
IGL02431:Fryl APN 5 73098308 missense probably benign 0.02
IGL02513:Fryl APN 5 73065293 missense probably damaging 1.00
IGL02557:Fryl APN 5 73098393 missense probably damaging 1.00
IGL02625:Fryl APN 5 73069877 intron probably benign
IGL02642:Fryl APN 5 73095466 missense probably benign
IGL02657:Fryl APN 5 73054860 missense probably benign 0.01
IGL02706:Fryl APN 5 73093163 missense probably benign 0.45
IGL03022:Fryl APN 5 73059383 missense possibly damaging 0.82
IGL03144:Fryl APN 5 73101455 missense probably null 0.22
IGL03155:Fryl APN 5 73076695 missense probably benign
IGL03183:Fryl APN 5 73076695 missense probably benign
IGL03275:Fryl APN 5 73148033 missense possibly damaging 0.47
IGL03310:Fryl APN 5 73136316 splice site probably benign
IGL03341:Fryl APN 5 73076695 missense probably benign
IGL03343:Fryl APN 5 73076695 missense probably benign
IGL03350:Fryl APN 5 73133306 missense probably damaging 0.99
IGL03357:Fryl APN 5 73054059 missense probably damaging 1.00
IGL03374:Fryl APN 5 73110281 splice site probably benign
IGL03375:Fryl APN 5 73088449 missense possibly damaging 0.91
bedeviled UTSW 5 73059500 missense probably damaging 1.00
Besotted UTSW 5 73072912 missense probably damaging 1.00
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0308:Fryl UTSW 5 73041604 splice site probably benign
R0312:Fryl UTSW 5 73072888 missense probably damaging 1.00
R0415:Fryl UTSW 5 73098414 missense probably damaging 0.99
R0440:Fryl UTSW 5 73086972 missense possibly damaging 0.91
R0446:Fryl UTSW 5 73097417 missense possibly damaging 0.91
R0566:Fryl UTSW 5 73064497 splice site probably benign
R0567:Fryl UTSW 5 73065391 missense possibly damaging 0.50
R0606:Fryl UTSW 5 73124734 missense probably benign 0.15
R0619:Fryl UTSW 5 73068731 missense probably benign 0.22
R0654:Fryl UTSW 5 73083372 missense probably benign 0.17
R0658:Fryl UTSW 5 73065359 missense probably damaging 1.00
R0707:Fryl UTSW 5 73083372 missense probably benign 0.17
R0744:Fryl UTSW 5 73089081 unclassified probably benign
R0745:Fryl UTSW 5 73071126 missense probably damaging 0.96
R0833:Fryl UTSW 5 73089081 unclassified probably benign
R0885:Fryl UTSW 5 73089196 missense probably damaging 0.97
R0894:Fryl UTSW 5 73041332 splice site probably benign
R1076:Fryl UTSW 5 73124673 unclassified probably benign
R1241:Fryl UTSW 5 73064925 splice site probably benign
R1241:Fryl UTSW 5 73110271 missense probably damaging 1.00
R1394:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1395:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1608:Fryl UTSW 5 73074751 nonsense probably null
R1664:Fryl UTSW 5 73059435 missense probably damaging 1.00
R1745:Fryl UTSW 5 73032861 splice site probably benign
R1937:Fryl UTSW 5 73133367 missense probably damaging 1.00
R1969:Fryl UTSW 5 73098266 missense probably benign 0.18
R1993:Fryl UTSW 5 73108493 missense probably damaging 1.00
R1994:Fryl UTSW 5 73108493 missense probably damaging 1.00
R2029:Fryl UTSW 5 73022122 nonsense probably null
R2036:Fryl UTSW 5 73022544 missense probably benign
R2036:Fryl UTSW 5 73107962 critical splice donor site probably null
R2088:Fryl UTSW 5 73065461 missense probably benign 0.02
R2105:Fryl UTSW 5 73122299 missense probably benign
R2106:Fryl UTSW 5 73098331 missense probably damaging 1.00
R2186:Fryl UTSW 5 73064975 missense probably damaging 1.00
R2239:Fryl UTSW 5 73108547 missense probably damaging 0.99
R2256:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2257:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2280:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2281:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2911:Fryl UTSW 5 73050456 missense probably damaging 0.99
R3019:Fryl UTSW 5 73082850 missense probably benign 0.01
R3416:Fryl UTSW 5 73108074 missense possibly damaging 0.84
R3783:Fryl UTSW 5 73101476 missense probably benign
R3787:Fryl UTSW 5 73101476 missense probably benign
R3837:Fryl UTSW 5 73071265 missense probably benign 0.03
R3969:Fryl UTSW 5 73112423 missense probably damaging 0.97
R4387:Fryl UTSW 5 73086560 missense possibly damaging 0.91
R4502:Fryl UTSW 5 73088397 missense probably damaging 1.00
R4658:Fryl UTSW 5 73081053 missense probably damaging 1.00
R4664:Fryl UTSW 5 73090679 missense possibly damaging 0.80
R4690:Fryl UTSW 5 73100293 missense probably benign
R4700:Fryl UTSW 5 73065538 missense possibly damaging 0.88
R4709:Fryl UTSW 5 73080972 missense probably benign 0.03
R4807:Fryl UTSW 5 73041362 missense probably benign 0.00
R4912:Fryl UTSW 5 73068782 frame shift probably null
R4948:Fryl UTSW 5 73089130 missense probably benign 0.08
R4959:Fryl UTSW 5 73035058 missense probably benign 0.00
R5062:Fryl UTSW 5 73075893 missense possibly damaging 0.89
R5067:Fryl UTSW 5 73057755 missense probably benign 0.13
R5071:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5072:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5073:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5074:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5139:Fryl UTSW 5 73090718 missense probably damaging 1.00
R5172:Fryl UTSW 5 73101673 missense possibly damaging 0.95
R5187:Fryl UTSW 5 73086600 missense possibly damaging 0.95
R5272:Fryl UTSW 5 73065136 nonsense probably null
R5275:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5295:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5344:Fryl UTSW 5 73104774 missense probably damaging 1.00
R5355:Fryl UTSW 5 73073904 missense probably damaging 1.00
R5716:Fryl UTSW 5 73100465 missense probably benign
R5778:Fryl UTSW 5 73072778 missense probably damaging 1.00
R5810:Fryl UTSW 5 73090755 missense probably benign 0.06
R5934:Fryl UTSW 5 73090717 missense probably damaging 1.00
R5948:Fryl UTSW 5 73097372 critical splice donor site probably null
R6005:Fryl UTSW 5 73083295 missense probably damaging 1.00
R6026:Fryl UTSW 5 73099997 missense probably benign 0.04
R6045:Fryl UTSW 5 73118551 missense probably damaging 0.99
R6185:Fryl UTSW 5 73112788 missense probably benign 0.43
R6247:Fryl UTSW 5 73065481 missense probably damaging 0.98
R6294:Fryl UTSW 5 73191759 intron probably benign
R6310:Fryl UTSW 5 73191761 intron probably benign
R6429:Fryl UTSW 5 73090751 missense possibly damaging 0.84
R6568:Fryl UTSW 5 73059516 missense probably damaging 1.00
R6636:Fryl UTSW 5 73133312 missense probably benign 0.01
R6664:Fryl UTSW 5 73132481 missense probably damaging 1.00
R6732:Fryl UTSW 5 73054781 missense probably damaging 1.00
R6750:Fryl UTSW 5 73022232 missense probably damaging 1.00
R6805:Fryl UTSW 5 73065094 missense probably benign 0.03
R6823:Fryl UTSW 5 73065217 missense probably damaging 0.99
R6855:Fryl UTSW 5 73059500 missense probably damaging 1.00
R6858:Fryl UTSW 5 73065032 missense probably damaging 1.00
R6868:Fryl UTSW 5 73068803 missense probably damaging 1.00
R6898:Fryl UTSW 5 73022142 missense probably damaging 0.96
R6908:Fryl UTSW 5 73022211 missense probably damaging 1.00
R6958:Fryl UTSW 5 73073929 missense possibly damaging 0.89
R6980:Fryl UTSW 5 73050430 missense probably benign 0.06
R7036:Fryl UTSW 5 73055608 missense probably benign 0.03
R7065:Fryl UTSW 5 73090756 missense probably damaging 0.96
R7097:Fryl UTSW 5 73073908 missense probably benign 0.31
R7171:Fryl UTSW 5 73122310 missense probably damaging 0.97
R7191:Fryl UTSW 5 73072912 missense probably damaging 1.00
R7207:Fryl UTSW 5 73065095 missense probably benign
R7236:Fryl UTSW 5 73108478 missense possibly damaging 0.66
R7334:Fryl UTSW 5 73047496 splice site probably null
R7425:Fryl UTSW 5 73104748 missense probably damaging 1.00
R7452:Fryl UTSW 5 73023988 missense probably damaging 1.00
R7479:Fryl UTSW 5 73097561 missense possibly damaging 0.71
R7535:Fryl UTSW 5 73098196 missense probably benign 0.15
R7538:Fryl UTSW 5 73022676 missense probably benign 0.09
R7544:Fryl UTSW 5 73081039 missense probably benign
R7548:Fryl UTSW 5 73191762 missense unknown
R7565:Fryl UTSW 5 73033720 missense probably benign 0.18
R7572:Fryl UTSW 5 73088396 missense possibly damaging 0.91
R7582:Fryl UTSW 5 73022500 critical splice donor site probably null
R7630:Fryl UTSW 5 73110245 missense possibly damaging 0.62
R7774:Fryl UTSW 5 73083384 missense probably benign 0.12
R7777:Fryl UTSW 5 73071298 missense probably damaging 0.98
R7917:Fryl UTSW 5 73054532 missense probably damaging 1.00
R7920:Fryl UTSW 5 73101807 splice site probably null
R8110:Fryl UTSW 5 73133277 missense probably benign 0.10
R8120:Fryl UTSW 5 73071184 missense probably benign 0.01
R8143:Fryl UTSW 5 73050339 missense probably benign 0.00
R8207:Fryl UTSW 5 73100500 splice site probably null
R8263:Fryl UTSW 5 73081005 missense probably damaging 1.00
R8350:Fryl UTSW 5 73068730 missense probably benign
R8359:Fryl UTSW 5 73075933 missense probably benign 0.39
R8387:Fryl UTSW 5 73136320 critical splice donor site probably null
R8403:Fryl UTSW 5 73118447 makesense probably null
R8450:Fryl UTSW 5 73068730 missense probably benign
R8514:Fryl UTSW 5 73085356 missense probably benign
R8536:Fryl UTSW 5 73100353 missense probably damaging 0.99
R8703:Fryl UTSW 5 73090654 missense probably damaging 0.99
R8708:Fryl UTSW 5 73132562 missense probably benign 0.01
R8783:Fryl UTSW 5 73068842 missense probably benign 0.45
R9028:Fryl UTSW 5 73098266 missense probably benign 0.18
R9045:Fryl UTSW 5 73024775 missense
R9063:Fryl UTSW 5 73081003 missense possibly damaging 0.70
R9096:Fryl UTSW 5 73108577 missense probably benign 0.01
R9345:Fryl UTSW 5 73050411 missense probably benign
R9386:Fryl UTSW 5 73191809 missense unknown
R9401:Fryl UTSW 5 73065220 nonsense probably null
R9497:Fryl UTSW 5 73057791 missense
R9514:Fryl UTSW 5 73104772 missense probably damaging 1.00
R9570:Fryl UTSW 5 73022155 missense probably benign 0.02
Z1088:Fryl UTSW 5 73090709 missense probably damaging 0.99
Z1088:Fryl UTSW 5 73090738 missense probably damaging 1.00
Z1176:Fryl UTSW 5 73072837 missense probably benign
Z1177:Fryl UTSW 5 73041595 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AACCTCCAAACTGTGCAGTC -3'
(R):5'- AAAAGAGATGCTTTGTGTTAGCTGG -3'

Sequencing Primer
(F):5'- CTCCAAACTGTGCAGTCATGATG -3'
(R):5'- GGAAGTGATTGGCATATGTCTTCC -3'
Posted On 2022-04-18