Incidental Mutation 'R9381:Trpm2'
ID 710038
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Name transient receptor potential cation channel, subfamily M, member 2
Synonyms LTRPC2, 9830168K16Rik, TRPC7, Trrp7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock # R9381 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 77907722-77970563 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 77911357 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1436 (I1436F)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
AlphaFold Q91YD4
Predicted Effect possibly damaging
Transcript: ENSMUST00000105401
AA Change: I1436F

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: I1436F

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
9930111J21Rik1 T A 11: 48,948,377 K461M probably damaging Het
Abhd16b A G 2: 181,494,088 Y261C probably damaging Het
Acadl T C 1: 66,854,646 T117A probably benign Het
Adamts15 A G 9: 30,902,520 V783A probably damaging Het
Aff1 A T 5: 103,833,867 Q624L possibly damaging Het
Afg3l2 T G 18: 67,442,381 E74A probably damaging Het
Aig1 T C 10: 13,647,673 E238G probably benign Het
Ankrd17 C T 5: 90,268,649 R1108Q probably damaging Het
Anks1 A T 17: 28,054,005 Y958F probably damaging Het
Arhgef28 C A 13: 97,899,761 Q1663H possibly damaging Het
Asb3 T C 11: 31,101,088 L475P probably damaging Het
Atg9a T A 1: 75,186,082 M430L probably benign Het
Bco1 T A 8: 117,110,892 V164E probably benign Het
Bhlhe40 T C 6: 108,665,283 L396P probably damaging Het
C5ar2 A T 7: 16,236,962 S347T probably damaging Het
Cdc42bpa T C 1: 180,141,483 S1212P probably damaging Het
Ceacam3 C G 7: 17,159,790 Q409E Het
Ces3b T C 8: 105,085,038 V62A probably benign Het
Dalrd3 A G 9: 108,571,043 probably null Het
Ddhd2 G T 8: 25,749,822 A288E probably benign Het
Dnah17 T A 11: 118,023,393 M4435L probably benign Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
E030025P04Rik A G 11: 109,139,558 Y168H unknown Het
Elavl2 T C 4: 91,308,772 N23S probably benign Het
Elfn1 T C 5: 139,973,707 V822A probably damaging Het
Emb G T 13: 117,220,560 probably benign Het
Exoc5 C T 14: 49,037,737 S202N probably benign Het
Fryl T C 5: 73,083,294 D1321G probably benign Het
Gm12258 C T 11: 58,859,181 T394I unknown Het
Gm28363 T A 1: 117,726,885 S85T probably damaging Het
Gm5724 T C 6: 141,765,764 I74V probably benign Het
H2-Q1 A G 17: 35,323,162 T237A probably damaging Het
Hectd4 A T 5: 121,334,429 I2743F possibly damaging Het
Hs3st3b1 C T 11: 63,921,866 G8S probably benign Het
Ighv1-16 T C 12: 114,665,978 N63S probably benign Het
Il20rb A G 9: 100,461,488 F238L possibly damaging Het
Il31ra A T 13: 112,531,719 F439I possibly damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kat2a T C 11: 100,711,866 Q132R possibly damaging Het
Kcnq2 A G 2: 181,109,769 I278T probably damaging Het
Lama1 T C 17: 67,737,484 V126A Het
Lama2 T A 10: 27,188,027 R1285* probably null Het
Larp1 A G 11: 58,058,706 T1054A probably benign Het
Lrp1 A T 10: 127,605,468 M262K probably benign Het
Lrrd1 A G 5: 3,851,074 I460V probably benign Het
Ltbp1 A T 17: 75,389,439 N1606I probably damaging Het
Mdga2 T C 12: 66,550,530 N730S possibly damaging Het
Mpzl1 T C 1: 165,601,754 H236R probably damaging Het
Mrps31 G A 8: 22,414,736 R47K probably damaging Het
Nae1 A T 8: 104,523,607 I218K probably benign Het
Npy2r T C 3: 82,541,049 T140A probably damaging Het
Nr2e1 T A 10: 42,563,472 L350F probably damaging Het
Nup210l C T 3: 90,199,866 P1570L probably benign Het
Olfr1489 G T 19: 13,633,283 M57I probably damaging Het
Olfr469 A C 7: 107,822,605 L288W probably damaging Het
Olfr557 A T 7: 102,698,447 M70L probably damaging Het
Pabpc1l G T 2: 164,025,503 C8F probably benign Het
Pafah1b3 A C 7: 25,295,274 F172V probably benign Het
Pcdhga6 A T 18: 37,708,318 T364S probably damaging Het
Ppp3cc T A 14: 70,224,992 M399L probably benign Het
Prpsap2 T C 11: 61,744,956 I173V probably benign Het
Rabggtb A T 3: 153,908,180 W252R probably damaging Het
Raph1 A G 1: 60,501,800 F351L unknown Het
Rasd2 T C 8: 75,221,961 S172P probably damaging Het
Rbm15 T C 3: 107,331,436 T549A probably benign Het
Reln A G 5: 22,344,204 Y69H possibly damaging Het
Samd3 T A 10: 26,271,745 N439K probably benign Het
Scap C A 9: 110,378,771 A516D probably damaging Het
Selplg T C 5: 113,819,856 T130A probably benign Het
Slc12a7 A G 13: 73,800,944 M697V probably benign Het
Slc22a29 A G 19: 8,218,477 I66T probably benign Het
Snrnp48 A C 13: 38,220,691 I241L probably damaging Het
Sptb C T 12: 76,587,518 E2140K probably benign Het
Strip2 T C 6: 29,927,334 S192P probably benign Het
Svil A T 18: 5,099,013 R1643S probably benign Het
Tbc1d2b A G 9: 90,219,086 V617A possibly damaging Het
Tmem102 T C 11: 69,804,315 E277G probably benign Het
Tmtc4 T G 14: 122,926,029 I648L probably benign Het
Togaram1 T C 12: 64,967,430 V485A probably damaging Het
Trim43b T C 9: 89,087,589 I269V probably benign Het
Ube2d3 A T 3: 135,462,961 I106F possibly damaging Het
Vdr G A 15: 97,857,452 R397C probably damaging Het
Vps50 T C 6: 3,592,433 S689P probably benign Het
Wipf2 A G 11: 98,896,242 T366A probably damaging Het
Zfp128 T C 7: 12,890,970 Y422H possibly damaging Het
Zfyve28 G A 5: 34,216,588 T694I probably benign Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
Fugit UTSW 10 77938368 missense probably damaging 1.00
scusate UTSW 10 77966994 nonsense probably null
temporal UTSW 10 77925682 missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77942999 missense probably benign 0.14
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1673:Trpm2 UTSW 10 77942944 missense probably benign
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2405:Trpm2 UTSW 10 77934724 missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3002:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77917792 missense probably benign 0.34
R5046:Trpm2 UTSW 10 77966018 missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5562:Trpm2 UTSW 10 77959939 missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77965980 missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6092:Trpm2 UTSW 10 77925682 missense probably benign 0.30
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77935891 missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77912592 missense probably benign
R7036:Trpm2 UTSW 10 77912592 missense probably benign
R7113:Trpm2 UTSW 10 77947931 missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77924014 missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77935876 critical splice donor site probably null
R7274:Trpm2 UTSW 10 77923555 missense probably benign 0.00
R7379:Trpm2 UTSW 10 77914734 missense probably benign
R7527:Trpm2 UTSW 10 77966060 missense probably benign 0.01
R7571:Trpm2 UTSW 10 77937950 missense probably benign 0.21
R7600:Trpm2 UTSW 10 77938051 missense probably benign 0.02
R7727:Trpm2 UTSW 10 77925789 missense probably benign 0.34
R7771:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R7844:Trpm2 UTSW 10 77923506 missense probably benign 0.00
R8158:Trpm2 UTSW 10 77947897 missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77936002 missense probably benign 0.06
R8275:Trpm2 UTSW 10 77966025 nonsense probably null
R8340:Trpm2 UTSW 10 77923624 nonsense probably null
R8354:Trpm2 UTSW 10 77933649 missense probably damaging 1.00
R8427:Trpm2 UTSW 10 77911402 missense possibly damaging 0.93
R8445:Trpm2 UTSW 10 77910252 missense probably damaging 1.00
R8769:Trpm2 UTSW 10 77932294 missense probably benign 0.00
R9144:Trpm2 UTSW 10 77929288 missense probably benign 0.01
R9286:Trpm2 UTSW 10 77941180 missense probably benign 0.06
R9319:Trpm2 UTSW 10 77942942 nonsense probably null
R9319:Trpm2 UTSW 10 77949198 missense probably damaging 1.00
R9457:Trpm2 UTSW 10 77911392 missense possibly damaging 0.82
R9477:Trpm2 UTSW 10 77911390 missense probably benign 0.12
Z1177:Trpm2 UTSW 10 77937868 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGTACCCTTCGGTCTATTCAG -3'
(R):5'- AGCCATGTTCAGATCCTGCC -3'

Sequencing Primer
(F):5'- GATGTGAATCTGCCTGCTAGCC -3'
(R):5'- CCCAGGAAGCCCCCTTC -3'
Posted On 2022-04-18