Incidental Mutation 'R9381:Dnah17'
ID 710051
Institutional Source Beutler Lab
Gene Symbol Dnah17
Ensembl Gene ENSMUSG00000033987
Gene Name dynein, axonemal, heavy chain 17
Synonyms Dnahcl1, LOC382552, 2810003K23Rik, Dnahc17
MMRRC Submission 068992-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9381 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 117912549-118021460 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 117914219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 4435 (M4435L)
Ref Sequence ENSEMBL: ENSMUSP00000101915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000100185] [ENSMUST00000106308] [ENSMUST00000132676] [ENSMUST00000132685]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000017859
SMART Domains Protein: ENSMUSP00000017859
Gene: ENSMUSG00000017715

DomainStartEndE-ValueType
low complexity region 11 56 N/A INTRINSIC
SCOP:d1f0ia1 70 287 4e-25 SMART
PDB:3HSI|C 81 464 7e-8 PDB
Blast:PLDc 211 237 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000084803
AA Change: M4407L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987
AA Change: M4407L

DomainStartEndE-ValueType
Pfam:DHC_N1 183 766 8.5e-142 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1260 1673 5.8e-135 PFAM
Pfam:AAA_6 1793 2023 6e-161 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 7.8e-13 PFAM
Pfam:AAA_7 2400 2671 1.1e-171 PFAM
Pfam:AAA_8 2748 3015 4.9e-166 PFAM
Pfam:MT 3027 3370 3.4e-214 PFAM
Pfam:AAA_9 3388 3615 2.4e-144 PFAM
Pfam:Dynein_heavy 3742 4452 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100185
SMART Domains Protein: ENSMUSP00000097760
Gene: ENSMUSG00000017715

DomainStartEndE-ValueType
SCOP:d1f0ia1 18 158 7e-13 SMART
Blast:PLDc 82 108 1e-8 BLAST
low complexity region 202 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106308
AA Change: M4435L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987
AA Change: M4435L

DomainStartEndE-ValueType
Pfam:DHC_N1 184 764 1.7e-152 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1262 1671 4.1e-132 PFAM
Pfam:AAA_6 1793 2023 7e-149 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 2.5e-11 PFAM
Pfam:AAA_7 2400 2671 4.4e-169 PFAM
Pfam:AAA_8 2748 3015 7.1e-163 PFAM
Pfam:MT 3027 3370 1.1e-210 PFAM
Pfam:AAA_9 3392 3614 1e-84 PFAM
Pfam:Dynein_heavy 3748 4479 3.5e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132676
SMART Domains Protein: ENSMUSP00000121973
Gene: ENSMUSG00000017715

DomainStartEndE-ValueType
low complexity region 12 57 N/A INTRINSIC
SCOP:d1f0ia1 71 288 3e-25 SMART
PDB:3HSI|C 82 475 3e-9 PDB
Blast:PLDc 212 238 2e-8 BLAST
Blast:PLDc 459 490 1e-13 BLAST
low complexity region 508 521 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132685
AA Change: M4413L
SMART Domains Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987
AA Change: M4413L

DomainStartEndE-ValueType
Pfam:DHC_N2 279 688 3.1e-132 PFAM
Pfam:AAA_6 811 1041 5.3e-149 PFAM
low complexity region 1110 1122 N/A INTRINSIC
Blast:AAA 1123 1354 1e-104 BLAST
Pfam:AAA_7 1452 1671 8.9e-134 PFAM
Pfam:AAA_8 1763 2030 5.4e-163 PFAM
Pfam:MT 2042 2168 6.8e-52 PFAM
Pfam:MT 2163 2412 8.2e-149 PFAM
Pfam:AAA_9 2434 2656 7.9e-85 PFAM
Pfam:Dynein_heavy 2790 3457 2.6e-209 PFAM
Pfam:Dynein_heavy 3460 3569 4.6e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
9930111J21Rik1 T A 11: 48,839,204 (GRCm39) K461M probably damaging Het
Abhd16b A G 2: 181,135,881 (GRCm39) Y261C probably damaging Het
Acadl T C 1: 66,893,805 (GRCm39) T117A probably benign Het
Adamts15 A G 9: 30,813,816 (GRCm39) V783A probably damaging Het
Aff1 A T 5: 103,981,733 (GRCm39) Q624L possibly damaging Het
Afg3l2 T G 18: 67,575,451 (GRCm39) E74A probably damaging Het
Aig1 T C 10: 13,523,417 (GRCm39) E238G probably benign Het
Ankrd17 C T 5: 90,416,508 (GRCm39) R1108Q probably damaging Het
Anks1 A T 17: 28,272,979 (GRCm39) Y958F probably damaging Het
Arhgef28 C A 13: 98,036,269 (GRCm39) Q1663H possibly damaging Het
Asb3 T C 11: 31,051,088 (GRCm39) L475P probably damaging Het
Atg9a T A 1: 75,162,726 (GRCm39) M430L probably benign Het
Bco1 T A 8: 117,837,631 (GRCm39) V164E probably benign Het
Bhlhe40 T C 6: 108,642,244 (GRCm39) L396P probably damaging Het
C5ar2 A T 7: 15,970,887 (GRCm39) S347T probably damaging Het
Cdc42bpa T C 1: 179,969,048 (GRCm39) S1212P probably damaging Het
Ceacam3 C G 7: 16,893,715 (GRCm39) Q409E Het
Ces3b T C 8: 105,811,670 (GRCm39) V62A probably benign Het
Dalrd3 A G 9: 108,448,242 (GRCm39) probably null Het
Ddhd2 G T 8: 26,239,849 (GRCm39) A288E probably benign Het
Dok1 T C 6: 83,009,972 (GRCm39) K46E probably damaging Het
E030025P04Rik A G 11: 109,030,384 (GRCm39) Y168H unknown Het
Elavl2 T C 4: 91,197,009 (GRCm39) N23S probably benign Het
Elfn1 T C 5: 139,959,462 (GRCm39) V822A probably damaging Het
Emb G T 13: 117,357,096 (GRCm39) probably benign Het
Exoc5 C T 14: 49,275,194 (GRCm39) S202N probably benign Het
Fryl T C 5: 73,240,637 (GRCm39) D1321G probably benign Het
Gm12258 C T 11: 58,750,007 (GRCm39) T394I unknown Het
Gm28363 T A 1: 117,654,615 (GRCm39) S85T probably damaging Het
H2-Q1 A G 17: 35,542,138 (GRCm39) T237A probably damaging Het
Hectd4 A T 5: 121,472,492 (GRCm39) I2743F possibly damaging Het
Hs3st3b1 C T 11: 63,812,692 (GRCm39) G8S probably benign Het
Ighv1-16 T C 12: 114,629,598 (GRCm39) N63S probably benign Het
Il20rb A G 9: 100,343,541 (GRCm39) F238L possibly damaging Het
Il31ra A T 13: 112,668,253 (GRCm39) F439I possibly damaging Het
Jup C T 11: 100,270,391 (GRCm39) C372Y probably damaging Het
Kat2a T C 11: 100,602,692 (GRCm39) Q132R possibly damaging Het
Kcnq2 A G 2: 180,751,562 (GRCm39) I278T probably damaging Het
Lama1 T C 17: 68,044,479 (GRCm39) V126A Het
Lama2 T A 10: 27,064,023 (GRCm39) R1285* probably null Het
Larp1 A G 11: 57,949,532 (GRCm39) T1054A probably benign Het
Lrp1 A T 10: 127,441,337 (GRCm39) M262K probably benign Het
Lrrd1 A G 5: 3,901,074 (GRCm39) I460V probably benign Het
Ltbp1 A T 17: 75,696,434 (GRCm39) N1606I probably damaging Het
Mdga2 T C 12: 66,597,304 (GRCm39) N730S possibly damaging Het
Mpzl1 T C 1: 165,429,323 (GRCm39) H236R probably damaging Het
Mrps31 G A 8: 22,904,752 (GRCm39) R47K probably damaging Het
Nae1 A T 8: 105,250,239 (GRCm39) I218K probably benign Het
Npy2r T C 3: 82,448,356 (GRCm39) T140A probably damaging Het
Nr2e1 T A 10: 42,439,468 (GRCm39) L350F probably damaging Het
Nup210l C T 3: 90,107,173 (GRCm39) P1570L probably benign Het
Or51d1 A T 7: 102,347,654 (GRCm39) M70L probably damaging Het
Or5b124 G T 19: 13,610,647 (GRCm39) M57I probably damaging Het
Or5p50 A C 7: 107,421,812 (GRCm39) L288W probably damaging Het
Pabpc1l G T 2: 163,867,423 (GRCm39) C8F probably benign Het
Pafah1b3 A C 7: 24,994,699 (GRCm39) F172V probably benign Het
Pcdhga6 A T 18: 37,841,371 (GRCm39) T364S probably damaging Het
Ppp3cc T A 14: 70,462,441 (GRCm39) M399L probably benign Het
Prpsap2 T C 11: 61,635,782 (GRCm39) I173V probably benign Het
Rabggtb A T 3: 153,613,817 (GRCm39) W252R probably damaging Het
Raph1 A G 1: 60,540,959 (GRCm39) F351L unknown Het
Rasd2 T C 8: 75,948,589 (GRCm39) S172P probably damaging Het
Rbm15 T C 3: 107,238,752 (GRCm39) T549A probably benign Het
Reln A G 5: 22,549,202 (GRCm39) Y69H possibly damaging Het
Samd3 T A 10: 26,147,643 (GRCm39) N439K probably benign Het
Scap C A 9: 110,207,839 (GRCm39) A516D probably damaging Het
Selplg T C 5: 113,957,917 (GRCm39) T130A probably benign Het
Slc12a7 A G 13: 73,949,063 (GRCm39) M697V probably benign Het
Slc22a29 A G 19: 8,195,841 (GRCm39) I66T probably benign Het
Slco1a7 T C 6: 141,711,490 (GRCm39) I74V probably benign Het
Snrnp48 A C 13: 38,404,667 (GRCm39) I241L probably damaging Het
Sptb C T 12: 76,634,292 (GRCm39) E2140K probably benign Het
Strip2 T C 6: 29,927,333 (GRCm39) S192P probably benign Het
Svil A T 18: 5,099,013 (GRCm39) R1643S probably benign Het
Tbc1d2b A G 9: 90,101,139 (GRCm39) V617A possibly damaging Het
Tmem102 T C 11: 69,695,141 (GRCm39) E277G probably benign Het
Tmtc4 T G 14: 123,163,441 (GRCm39) I648L probably benign Het
Togaram1 T C 12: 65,014,204 (GRCm39) V485A probably damaging Het
Trim43b T C 9: 88,969,642 (GRCm39) I269V probably benign Het
Trpm2 T A 10: 77,747,191 (GRCm39) I1436F possibly damaging Het
Ube2d3 A T 3: 135,168,722 (GRCm39) I106F possibly damaging Het
Vdr G A 15: 97,755,333 (GRCm39) R397C probably damaging Het
Vps50 T C 6: 3,592,433 (GRCm39) S689P probably benign Het
Wipf2 A G 11: 98,787,068 (GRCm39) T366A probably damaging Het
Zfp128 T C 7: 12,624,897 (GRCm39) Y422H possibly damaging Het
Zfyve28 G A 5: 34,373,932 (GRCm39) T694I probably benign Het
Other mutations in Dnah17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Dnah17 APN 11 117,979,040 (GRCm39) missense possibly damaging 0.81
IGL00531:Dnah17 APN 11 117,933,999 (GRCm39) missense probably damaging 0.97
IGL00764:Dnah17 APN 11 117,987,311 (GRCm39) missense probably damaging 0.99
IGL00795:Dnah17 APN 11 117,984,460 (GRCm39) missense probably benign 0.35
IGL00823:Dnah17 APN 11 117,937,987 (GRCm39) missense probably benign 0.22
IGL01145:Dnah17 APN 11 117,937,999 (GRCm39) missense possibly damaging 0.63
IGL01433:Dnah17 APN 11 117,940,760 (GRCm39) missense probably damaging 1.00
IGL01454:Dnah17 APN 11 117,949,223 (GRCm39) missense probably damaging 1.00
IGL01545:Dnah17 APN 11 118,010,394 (GRCm39) missense probably damaging 1.00
IGL01548:Dnah17 APN 11 117,989,438 (GRCm39) missense probably benign 0.21
IGL01557:Dnah17 APN 11 117,964,512 (GRCm39) missense probably damaging 0.98
IGL01632:Dnah17 APN 11 117,924,707 (GRCm39) missense probably damaging 1.00
IGL01636:Dnah17 APN 11 117,931,882 (GRCm39) missense probably benign 0.03
IGL01672:Dnah17 APN 11 117,932,986 (GRCm39) missense probably damaging 0.97
IGL01822:Dnah17 APN 11 117,972,819 (GRCm39) missense probably damaging 1.00
IGL01869:Dnah17 APN 11 117,943,502 (GRCm39) missense probably benign 0.09
IGL01916:Dnah17 APN 11 118,016,114 (GRCm39) missense probably benign 0.00
IGL02131:Dnah17 APN 11 117,963,734 (GRCm39) missense probably damaging 1.00
IGL02154:Dnah17 APN 11 118,015,087 (GRCm39) missense probably benign 0.01
IGL02220:Dnah17 APN 11 117,963,793 (GRCm39) nonsense probably null
IGL02454:Dnah17 APN 11 117,971,593 (GRCm39) missense probably damaging 0.98
IGL02458:Dnah17 APN 11 117,927,176 (GRCm39) missense probably damaging 1.00
IGL02588:Dnah17 APN 11 117,916,479 (GRCm39) missense possibly damaging 0.95
IGL02865:Dnah17 APN 11 117,964,374 (GRCm39) missense probably damaging 1.00
IGL02881:Dnah17 APN 11 117,932,944 (GRCm39) missense probably damaging 1.00
IGL02952:Dnah17 APN 11 117,979,094 (GRCm39) missense probably benign 0.03
IGL03382:Dnah17 APN 11 117,972,769 (GRCm39) missense probably damaging 1.00
IGL03389:Dnah17 APN 11 117,985,805 (GRCm39) missense probably damaging 1.00
ergos UTSW 11 117,931,984 (GRCm39) splice site probably benign
watt UTSW 11 117,971,592 (GRCm39) missense probably damaging 0.96
PIT4280001:Dnah17 UTSW 11 117,989,408 (GRCm39) missense possibly damaging 0.85
R0004:Dnah17 UTSW 11 117,950,918 (GRCm39) missense possibly damaging 0.90
R0112:Dnah17 UTSW 11 117,965,260 (GRCm39) missense possibly damaging 0.82
R0116:Dnah17 UTSW 11 117,949,132 (GRCm39) missense probably benign 0.01
R0157:Dnah17 UTSW 11 118,017,997 (GRCm39) missense probably benign
R0320:Dnah17 UTSW 11 117,943,500 (GRCm39) missense possibly damaging 0.56
R0362:Dnah17 UTSW 11 117,989,365 (GRCm39) missense probably benign 0.10
R0382:Dnah17 UTSW 11 118,019,822 (GRCm39) missense probably damaging 1.00
R0383:Dnah17 UTSW 11 117,958,373 (GRCm39) missense probably benign
R0400:Dnah17 UTSW 11 117,972,904 (GRCm39) missense probably damaging 1.00
R0420:Dnah17 UTSW 11 117,930,765 (GRCm39) missense probably damaging 1.00
R0483:Dnah17 UTSW 11 117,937,950 (GRCm39) missense probably benign
R0533:Dnah17 UTSW 11 118,001,363 (GRCm39) missense possibly damaging 0.50
R0562:Dnah17 UTSW 11 117,963,726 (GRCm39) missense probably damaging 1.00
R0564:Dnah17 UTSW 11 117,973,807 (GRCm39) missense probably damaging 1.00
R0604:Dnah17 UTSW 11 118,012,297 (GRCm39) missense probably benign 0.00
R0608:Dnah17 UTSW 11 117,981,575 (GRCm39) nonsense probably null
R0614:Dnah17 UTSW 11 117,961,394 (GRCm39) splice site probably benign
R0632:Dnah17 UTSW 11 117,958,508 (GRCm39) splice site probably benign
R0831:Dnah17 UTSW 11 117,951,097 (GRCm39) missense probably damaging 0.99
R0838:Dnah17 UTSW 11 117,950,930 (GRCm39) missense probably damaging 1.00
R0879:Dnah17 UTSW 11 117,947,661 (GRCm39) splice site probably benign
R1061:Dnah17 UTSW 11 117,943,514 (GRCm39) missense possibly damaging 0.51
R1190:Dnah17 UTSW 11 117,933,001 (GRCm39) missense probably damaging 1.00
R1293:Dnah17 UTSW 11 118,017,963 (GRCm39) critical splice donor site probably null
R1297:Dnah17 UTSW 11 118,012,192 (GRCm39) splice site probably benign
R1332:Dnah17 UTSW 11 117,934,041 (GRCm39) missense possibly damaging 0.70
R1336:Dnah17 UTSW 11 117,934,041 (GRCm39) missense possibly damaging 0.70
R1364:Dnah17 UTSW 11 118,016,432 (GRCm39) splice site probably benign
R1418:Dnah17 UTSW 11 117,964,849 (GRCm39) missense probably damaging 0.98
R1432:Dnah17 UTSW 11 117,914,153 (GRCm39) missense probably damaging 1.00
R1497:Dnah17 UTSW 11 118,005,059 (GRCm39) missense probably damaging 1.00
R1500:Dnah17 UTSW 11 117,991,879 (GRCm39) missense probably benign
R1506:Dnah17 UTSW 11 118,016,213 (GRCm39) missense possibly damaging 0.53
R1512:Dnah17 UTSW 11 117,985,841 (GRCm39) missense probably benign
R1567:Dnah17 UTSW 11 118,016,811 (GRCm39) missense probably damaging 1.00
R1597:Dnah17 UTSW 11 117,994,324 (GRCm39) splice site probably benign
R1665:Dnah17 UTSW 11 118,012,321 (GRCm39) splice site probably benign
R1703:Dnah17 UTSW 11 117,917,575 (GRCm39) missense probably damaging 1.00
R1716:Dnah17 UTSW 11 117,923,424 (GRCm39) missense probably benign 0.00
R1727:Dnah17 UTSW 11 117,987,362 (GRCm39) nonsense probably null
R1727:Dnah17 UTSW 11 117,961,315 (GRCm39) missense probably damaging 0.98
R1728:Dnah17 UTSW 11 117,960,345 (GRCm39) missense possibly damaging 0.76
R1784:Dnah17 UTSW 11 117,960,345 (GRCm39) missense possibly damaging 0.76
R1852:Dnah17 UTSW 11 118,012,742 (GRCm39) missense probably damaging 0.97
R1869:Dnah17 UTSW 11 117,938,015 (GRCm39) nonsense probably null
R1886:Dnah17 UTSW 11 117,998,987 (GRCm39) missense possibly damaging 0.62
R1893:Dnah17 UTSW 11 117,957,794 (GRCm39) missense probably benign 0.00
R1954:Dnah17 UTSW 11 117,915,557 (GRCm39) missense probably damaging 1.00
R1969:Dnah17 UTSW 11 117,995,361 (GRCm39) missense probably benign 0.00
R1971:Dnah17 UTSW 11 117,995,361 (GRCm39) missense probably benign 0.00
R1975:Dnah17 UTSW 11 117,987,362 (GRCm39) nonsense probably null
R1977:Dnah17 UTSW 11 118,003,417 (GRCm39) missense possibly damaging 0.52
R2055:Dnah17 UTSW 11 117,958,357 (GRCm39) missense probably benign 0.00
R2115:Dnah17 UTSW 11 118,010,628 (GRCm39) missense probably benign 0.00
R2132:Dnah17 UTSW 11 117,924,573 (GRCm39) missense probably damaging 0.98
R2200:Dnah17 UTSW 11 117,993,235 (GRCm39) splice site probably benign
R2277:Dnah17 UTSW 11 117,987,387 (GRCm39) missense possibly damaging 0.81
R2279:Dnah17 UTSW 11 117,987,387 (GRCm39) missense possibly damaging 0.81
R2400:Dnah17 UTSW 11 118,017,210 (GRCm39) critical splice acceptor site probably null
R2402:Dnah17 UTSW 11 118,016,800 (GRCm39) missense probably benign 0.10
R2497:Dnah17 UTSW 11 117,977,850 (GRCm39) splice site probably null
R2923:Dnah17 UTSW 11 117,984,373 (GRCm39) missense probably damaging 1.00
R3121:Dnah17 UTSW 11 117,931,912 (GRCm39) missense probably damaging 1.00
R3236:Dnah17 UTSW 11 117,985,680 (GRCm39) missense probably benign 0.08
R3237:Dnah17 UTSW 11 117,985,680 (GRCm39) missense probably benign 0.08
R3498:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3499:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3746:Dnah17 UTSW 11 117,973,742 (GRCm39) missense probably benign 0.00
R3749:Dnah17 UTSW 11 117,973,742 (GRCm39) missense probably benign 0.00
R3762:Dnah17 UTSW 11 117,995,352 (GRCm39) missense probably benign 0.00
R3826:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3828:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3829:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3877:Dnah17 UTSW 11 117,915,533 (GRCm39) missense probably damaging 1.00
R3899:Dnah17 UTSW 11 117,985,634 (GRCm39) missense possibly damaging 0.78
R3900:Dnah17 UTSW 11 117,985,634 (GRCm39) missense possibly damaging 0.78
R3911:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3913:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3930:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3931:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3969:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3970:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R4056:Dnah17 UTSW 11 117,961,364 (GRCm39) missense probably benign 0.05
R4113:Dnah17 UTSW 11 118,003,420 (GRCm39) missense possibly damaging 0.50
R4295:Dnah17 UTSW 11 118,009,598 (GRCm39) missense probably damaging 1.00
R4324:Dnah17 UTSW 11 117,985,039 (GRCm39) missense probably benign 0.01
R4412:Dnah17 UTSW 11 117,964,509 (GRCm39) missense probably damaging 1.00
R4413:Dnah17 UTSW 11 117,915,994 (GRCm39) missense probably benign 0.00
R4422:Dnah17 UTSW 11 117,972,799 (GRCm39) missense possibly damaging 0.91
R4552:Dnah17 UTSW 11 117,943,769 (GRCm39) missense possibly damaging 0.79
R4669:Dnah17 UTSW 11 117,965,119 (GRCm39) missense probably benign 0.02
R4677:Dnah17 UTSW 11 118,010,640 (GRCm39) missense probably damaging 1.00
R4716:Dnah17 UTSW 11 117,964,474 (GRCm39) missense probably benign 0.02
R4832:Dnah17 UTSW 11 117,917,606 (GRCm39) missense probably damaging 1.00
R4868:Dnah17 UTSW 11 117,999,038 (GRCm39) missense probably benign 0.03
R4897:Dnah17 UTSW 11 117,969,419 (GRCm39) missense probably damaging 1.00
R4928:Dnah17 UTSW 11 117,918,259 (GRCm39) missense probably damaging 1.00
R4937:Dnah17 UTSW 11 117,932,980 (GRCm39) missense probably damaging 1.00
R4957:Dnah17 UTSW 11 117,965,124 (GRCm39) missense probably benign 0.44
R5008:Dnah17 UTSW 11 118,001,403 (GRCm39) missense probably benign 0.01
R5016:Dnah17 UTSW 11 117,971,592 (GRCm39) missense probably damaging 0.96
R5027:Dnah17 UTSW 11 117,993,365 (GRCm39) missense probably benign 0.01
R5133:Dnah17 UTSW 11 118,007,939 (GRCm39) missense probably benign 0.00
R5140:Dnah17 UTSW 11 117,977,771 (GRCm39) missense probably damaging 1.00
R5146:Dnah17 UTSW 11 118,005,005 (GRCm39) missense probably damaging 0.99
R5151:Dnah17 UTSW 11 117,918,293 (GRCm39) missense probably damaging 1.00
R5153:Dnah17 UTSW 11 117,973,800 (GRCm39) nonsense probably null
R5192:Dnah17 UTSW 11 117,925,185 (GRCm39) missense possibly damaging 0.96
R5315:Dnah17 UTSW 11 118,018,109 (GRCm39) missense possibly damaging 0.79
R5317:Dnah17 UTSW 11 118,018,109 (GRCm39) missense possibly damaging 0.79
R5335:Dnah17 UTSW 11 118,003,340 (GRCm39) missense probably damaging 1.00
R5379:Dnah17 UTSW 11 118,008,029 (GRCm39) intron probably benign
R5396:Dnah17 UTSW 11 118,018,108 (GRCm39) missense probably benign
R5418:Dnah17 UTSW 11 117,985,810 (GRCm39) missense probably benign 0.04
R5534:Dnah17 UTSW 11 117,943,596 (GRCm39) missense possibly damaging 0.83
R5539:Dnah17 UTSW 11 117,964,486 (GRCm39) missense probably benign 0.03
R5594:Dnah17 UTSW 11 117,934,055 (GRCm39) splice site probably null
R5634:Dnah17 UTSW 11 117,943,752 (GRCm39) splice site probably null
R5696:Dnah17 UTSW 11 117,991,882 (GRCm39) missense probably benign 0.44
R5802:Dnah17 UTSW 11 117,927,272 (GRCm39) missense possibly damaging 0.79
R5826:Dnah17 UTSW 11 117,925,193 (GRCm39) missense probably damaging 1.00
R5873:Dnah17 UTSW 11 117,947,723 (GRCm39) missense probably benign 0.01
R5898:Dnah17 UTSW 11 118,005,039 (GRCm39) missense probably benign 0.00
R5934:Dnah17 UTSW 11 117,931,928 (GRCm39) missense probably benign
R6030:Dnah17 UTSW 11 117,916,375 (GRCm39) missense probably benign 0.32
R6030:Dnah17 UTSW 11 117,916,375 (GRCm39) missense probably benign 0.32
R6038:Dnah17 UTSW 11 117,946,715 (GRCm39) missense probably benign 0.00
R6038:Dnah17 UTSW 11 117,946,715 (GRCm39) missense probably benign 0.00
R6113:Dnah17 UTSW 11 118,017,101 (GRCm39) missense probably damaging 1.00
R6117:Dnah17 UTSW 11 118,010,397 (GRCm39) missense probably benign 0.00
R6137:Dnah17 UTSW 11 117,916,480 (GRCm39) missense probably damaging 1.00
R6173:Dnah17 UTSW 11 117,930,772 (GRCm39) missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118,017,150 (GRCm39) missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118,017,148 (GRCm39) missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118,017,149 (GRCm39) nonsense probably null
R6260:Dnah17 UTSW 11 118,017,149 (GRCm39) nonsense probably null
R6260:Dnah17 UTSW 11 118,017,150 (GRCm39) missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118,017,148 (GRCm39) missense probably damaging 1.00
R6278:Dnah17 UTSW 11 118,017,116 (GRCm39) missense probably damaging 0.99
R6298:Dnah17 UTSW 11 117,998,987 (GRCm39) missense probably benign 0.00
R6300:Dnah17 UTSW 11 117,925,136 (GRCm39) missense probably damaging 1.00
R6302:Dnah17 UTSW 11 118,019,981 (GRCm39) missense probably benign 0.09
R6363:Dnah17 UTSW 11 118,001,331 (GRCm39) missense probably benign
R6381:Dnah17 UTSW 11 118,020,011 (GRCm39) missense probably benign 0.08
R6418:Dnah17 UTSW 11 118,020,023 (GRCm39) missense probably damaging 0.99
R6660:Dnah17 UTSW 11 117,991,014 (GRCm39) missense probably benign
R6803:Dnah17 UTSW 11 118,016,198 (GRCm39) missense probably benign 0.00
R6820:Dnah17 UTSW 11 117,959,826 (GRCm39) missense probably damaging 0.99
R6885:Dnah17 UTSW 11 117,981,598 (GRCm39) missense possibly damaging 0.47
R6921:Dnah17 UTSW 11 117,932,310 (GRCm39) missense probably damaging 0.98
R6932:Dnah17 UTSW 11 117,950,905 (GRCm39) missense possibly damaging 0.95
R6954:Dnah17 UTSW 11 117,957,258 (GRCm39) missense probably damaging 1.00
R7000:Dnah17 UTSW 11 117,916,528 (GRCm39) critical splice acceptor site probably null
R7007:Dnah17 UTSW 11 118,009,697 (GRCm39) missense possibly damaging 0.92
R7048:Dnah17 UTSW 11 117,936,944 (GRCm39) missense possibly damaging 0.80
R7056:Dnah17 UTSW 11 118,016,212 (GRCm39) missense probably benign
R7131:Dnah17 UTSW 11 117,970,484 (GRCm39) missense probably benign 0.14
R7143:Dnah17 UTSW 11 117,976,956 (GRCm39) missense probably damaging 1.00
R7146:Dnah17 UTSW 11 117,972,936 (GRCm39) missense probably damaging 0.98
R7147:Dnah17 UTSW 11 117,985,755 (GRCm39) missense probably benign 0.31
R7172:Dnah17 UTSW 11 117,931,957 (GRCm39) nonsense probably null
R7183:Dnah17 UTSW 11 118,020,014 (GRCm39) missense probably benign
R7297:Dnah17 UTSW 11 117,994,182 (GRCm39) missense probably damaging 0.98
R7297:Dnah17 UTSW 11 117,946,556 (GRCm39) critical splice donor site probably null
R7367:Dnah17 UTSW 11 118,006,022 (GRCm39) missense probably benign
R7398:Dnah17 UTSW 11 117,971,550 (GRCm39) missense probably damaging 0.96
R7426:Dnah17 UTSW 11 117,981,543 (GRCm39) missense probably null 0.79
R7524:Dnah17 UTSW 11 118,012,307 (GRCm39) missense probably benign 0.03
R7529:Dnah17 UTSW 11 117,940,692 (GRCm39) critical splice donor site probably null
R7615:Dnah17 UTSW 11 118,001,373 (GRCm39) nonsense probably null
R7681:Dnah17 UTSW 11 117,916,012 (GRCm39) missense probably damaging 1.00
R7702:Dnah17 UTSW 11 118,012,304 (GRCm39) missense possibly damaging 0.64
R7702:Dnah17 UTSW 11 117,916,466 (GRCm39) missense probably benign 0.00
R7713:Dnah17 UTSW 11 117,915,997 (GRCm39) missense probably benign 0.02
R7809:Dnah17 UTSW 11 117,995,462 (GRCm39) missense probably benign 0.09
R7842:Dnah17 UTSW 11 117,970,508 (GRCm39) critical splice acceptor site probably null
R7935:Dnah17 UTSW 11 118,018,048 (GRCm39) missense probably benign 0.20
R7951:Dnah17 UTSW 11 118,009,592 (GRCm39) missense possibly damaging 0.64
R8070:Dnah17 UTSW 11 117,915,497 (GRCm39) missense probably damaging 0.97
R8098:Dnah17 UTSW 11 117,941,193 (GRCm39) missense probably damaging 1.00
R8101:Dnah17 UTSW 11 118,016,744 (GRCm39) missense probably benign
R8177:Dnah17 UTSW 11 118,019,753 (GRCm39) missense possibly damaging 0.60
R8343:Dnah17 UTSW 11 118,005,021 (GRCm39) missense probably benign
R8350:Dnah17 UTSW 11 117,977,873 (GRCm39) missense probably damaging 0.98
R8393:Dnah17 UTSW 11 117,947,855 (GRCm39) missense probably damaging 1.00
R8401:Dnah17 UTSW 11 117,915,485 (GRCm39) missense probably damaging 0.96
R8418:Dnah17 UTSW 11 117,994,284 (GRCm39) missense probably benign 0.01
R8450:Dnah17 UTSW 11 117,977,873 (GRCm39) missense probably damaging 0.98
R8546:Dnah17 UTSW 11 118,015,101 (GRCm39) missense probably benign 0.00
R8697:Dnah17 UTSW 11 117,976,985 (GRCm39) missense possibly damaging 0.96
R8710:Dnah17 UTSW 11 117,932,973 (GRCm39) missense probably damaging 1.00
R8713:Dnah17 UTSW 11 117,979,028 (GRCm39) missense probably damaging 1.00
R8722:Dnah17 UTSW 11 117,961,283 (GRCm39) nonsense probably null
R8797:Dnah17 UTSW 11 117,992,201 (GRCm39) missense probably benign 0.00
R8953:Dnah17 UTSW 11 118,016,238 (GRCm39) splice site probably benign
R8965:Dnah17 UTSW 11 117,915,492 (GRCm39) missense probably damaging 1.00
R8976:Dnah17 UTSW 11 117,917,666 (GRCm39) missense probably damaging 1.00
R9090:Dnah17 UTSW 11 117,931,870 (GRCm39) missense probably damaging 1.00
R9128:Dnah17 UTSW 11 117,937,004 (GRCm39) missense possibly damaging 0.76
R9134:Dnah17 UTSW 11 117,978,972 (GRCm39) missense probably damaging 1.00
R9245:Dnah17 UTSW 11 118,016,503 (GRCm39) missense probably benign 0.02
R9251:Dnah17 UTSW 11 118,012,618 (GRCm39) missense probably benign 0.03
R9271:Dnah17 UTSW 11 117,931,870 (GRCm39) missense probably damaging 1.00
R9367:Dnah17 UTSW 11 118,012,212 (GRCm39) missense possibly damaging 0.93
R9367:Dnah17 UTSW 11 117,987,464 (GRCm39) missense possibly damaging 0.95
R9405:Dnah17 UTSW 11 118,009,737 (GRCm39) missense probably benign
R9449:Dnah17 UTSW 11 117,987,452 (GRCm39) missense probably benign 0.07
R9517:Dnah17 UTSW 11 117,915,440 (GRCm39) missense possibly damaging 0.76
R9588:Dnah17 UTSW 11 118,012,783 (GRCm39) missense probably benign 0.00
R9629:Dnah17 UTSW 11 117,979,804 (GRCm39) missense probably damaging 1.00
R9654:Dnah17 UTSW 11 117,927,156 (GRCm39) critical splice donor site probably null
R9655:Dnah17 UTSW 11 117,971,649 (GRCm39) missense possibly damaging 0.94
R9662:Dnah17 UTSW 11 117,925,166 (GRCm39) missense probably damaging 0.97
R9686:Dnah17 UTSW 11 117,979,048 (GRCm39) missense possibly damaging 0.46
R9689:Dnah17 UTSW 11 117,963,731 (GRCm39) missense probably damaging 1.00
R9706:Dnah17 UTSW 11 118,017,026 (GRCm39) missense probably damaging 1.00
X0058:Dnah17 UTSW 11 117,973,751 (GRCm39) missense probably damaging 1.00
Z1176:Dnah17 UTSW 11 118,017,992 (GRCm39) missense probably benign 0.01
Z1177:Dnah17 UTSW 11 117,977,786 (GRCm39) missense probably damaging 1.00
Z1177:Dnah17 UTSW 11 117,969,389 (GRCm39) missense possibly damaging 0.91
Z1177:Dnah17 UTSW 11 118,017,968 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCGGCCTAGTCACACTGTAG -3'
(R):5'- ACTGGCCTGTCTCTGAAAAG -3'

Sequencing Primer
(F):5'- CTAGTCACACTGTAGGTAGGGCTAC -3'
(R):5'- TTTTTCACGGTCAGCATCCAAACAG -3'
Posted On 2022-04-18