Incidental Mutation 'R9381:Dnah17'
ID 710051
Institutional Source Beutler Lab
Gene Symbol Dnah17
Ensembl Gene ENSMUSG00000033987
Gene Name dynein, axonemal, heavy chain 17
Synonyms LOC382552, Dnahcl1, 2810003K23Rik, Dnahc17
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9381 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 118021723-118130634 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118023393 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 4435 (M4435L)
Ref Sequence ENSEMBL: ENSMUSP00000101915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000100185] [ENSMUST00000106308] [ENSMUST00000132676] [ENSMUST00000132685]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000017859
SMART Domains Protein: ENSMUSP00000017859
Gene: ENSMUSG00000017715

DomainStartEndE-ValueType
low complexity region 11 56 N/A INTRINSIC
SCOP:d1f0ia1 70 287 4e-25 SMART
PDB:3HSI|C 81 464 7e-8 PDB
Blast:PLDc 211 237 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000084803
AA Change: M4407L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987
AA Change: M4407L

DomainStartEndE-ValueType
Pfam:DHC_N1 183 766 8.5e-142 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1260 1673 5.8e-135 PFAM
Pfam:AAA_6 1793 2023 6e-161 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 7.8e-13 PFAM
Pfam:AAA_7 2400 2671 1.1e-171 PFAM
Pfam:AAA_8 2748 3015 4.9e-166 PFAM
Pfam:MT 3027 3370 3.4e-214 PFAM
Pfam:AAA_9 3388 3615 2.4e-144 PFAM
Pfam:Dynein_heavy 3742 4452 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100185
SMART Domains Protein: ENSMUSP00000097760
Gene: ENSMUSG00000017715

DomainStartEndE-ValueType
SCOP:d1f0ia1 18 158 7e-13 SMART
Blast:PLDc 82 108 1e-8 BLAST
low complexity region 202 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106308
AA Change: M4435L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987
AA Change: M4435L

DomainStartEndE-ValueType
Pfam:DHC_N1 184 764 1.7e-152 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1262 1671 4.1e-132 PFAM
Pfam:AAA_6 1793 2023 7e-149 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 2.5e-11 PFAM
Pfam:AAA_7 2400 2671 4.4e-169 PFAM
Pfam:AAA_8 2748 3015 7.1e-163 PFAM
Pfam:MT 3027 3370 1.1e-210 PFAM
Pfam:AAA_9 3392 3614 1e-84 PFAM
Pfam:Dynein_heavy 3748 4479 3.5e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132676
SMART Domains Protein: ENSMUSP00000121973
Gene: ENSMUSG00000017715

DomainStartEndE-ValueType
low complexity region 12 57 N/A INTRINSIC
SCOP:d1f0ia1 71 288 3e-25 SMART
PDB:3HSI|C 82 475 3e-9 PDB
Blast:PLDc 212 238 2e-8 BLAST
Blast:PLDc 459 490 1e-13 BLAST
low complexity region 508 521 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132685
AA Change: M4413L
SMART Domains Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987
AA Change: M4413L

DomainStartEndE-ValueType
Pfam:DHC_N2 279 688 3.1e-132 PFAM
Pfam:AAA_6 811 1041 5.3e-149 PFAM
low complexity region 1110 1122 N/A INTRINSIC
Blast:AAA 1123 1354 1e-104 BLAST
Pfam:AAA_7 1452 1671 8.9e-134 PFAM
Pfam:AAA_8 1763 2030 5.4e-163 PFAM
Pfam:MT 2042 2168 6.8e-52 PFAM
Pfam:MT 2163 2412 8.2e-149 PFAM
Pfam:AAA_9 2434 2656 7.9e-85 PFAM
Pfam:Dynein_heavy 2790 3457 2.6e-209 PFAM
Pfam:Dynein_heavy 3460 3569 4.6e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
9930111J21Rik1 T A 11: 48,948,377 K461M probably damaging Het
Abhd16b A G 2: 181,494,088 Y261C probably damaging Het
Acadl T C 1: 66,854,646 T117A probably benign Het
Adamts15 A G 9: 30,902,520 V783A probably damaging Het
Aff1 A T 5: 103,833,867 Q624L possibly damaging Het
Afg3l2 T G 18: 67,442,381 E74A probably damaging Het
Aig1 T C 10: 13,647,673 E238G probably benign Het
Ankrd17 C T 5: 90,268,649 R1108Q probably damaging Het
Anks1 A T 17: 28,054,005 Y958F probably damaging Het
Arhgef28 C A 13: 97,899,761 Q1663H possibly damaging Het
Asb3 T C 11: 31,101,088 L475P probably damaging Het
Atg9a T A 1: 75,186,082 M430L probably benign Het
Bco1 T A 8: 117,110,892 V164E probably benign Het
Bhlhe40 T C 6: 108,665,283 L396P probably damaging Het
C5ar2 A T 7: 16,236,962 S347T probably damaging Het
Cdc42bpa T C 1: 180,141,483 S1212P probably damaging Het
Ceacam3 C G 7: 17,159,790 Q409E Het
Ces3b T C 8: 105,085,038 V62A probably benign Het
Dalrd3 A G 9: 108,571,043 probably null Het
Ddhd2 G T 8: 25,749,822 A288E probably benign Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
E030025P04Rik A G 11: 109,139,558 Y168H unknown Het
Elavl2 T C 4: 91,308,772 N23S probably benign Het
Elfn1 T C 5: 139,973,707 V822A probably damaging Het
Emb G T 13: 117,220,560 probably benign Het
Exoc5 C T 14: 49,037,737 S202N probably benign Het
Fryl T C 5: 73,083,294 D1321G probably benign Het
Gm12258 C T 11: 58,859,181 T394I unknown Het
Gm28363 T A 1: 117,726,885 S85T probably damaging Het
Gm5724 T C 6: 141,765,764 I74V probably benign Het
H2-Q1 A G 17: 35,323,162 T237A probably damaging Het
Hectd4 A T 5: 121,334,429 I2743F possibly damaging Het
Hs3st3b1 C T 11: 63,921,866 G8S probably benign Het
Ighv1-16 T C 12: 114,665,978 N63S probably benign Het
Il20rb A G 9: 100,461,488 F238L possibly damaging Het
Il31ra A T 13: 112,531,719 F439I possibly damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kat2a T C 11: 100,711,866 Q132R possibly damaging Het
Kcnq2 A G 2: 181,109,769 I278T probably damaging Het
Lama1 T C 17: 67,737,484 V126A Het
Lama2 T A 10: 27,188,027 R1285* probably null Het
Larp1 A G 11: 58,058,706 T1054A probably benign Het
Lrp1 A T 10: 127,605,468 M262K probably benign Het
Lrrd1 A G 5: 3,851,074 I460V probably benign Het
Ltbp1 A T 17: 75,389,439 N1606I probably damaging Het
Mdga2 T C 12: 66,550,530 N730S possibly damaging Het
Mpzl1 T C 1: 165,601,754 H236R probably damaging Het
Mrps31 G A 8: 22,414,736 R47K probably damaging Het
Nae1 A T 8: 104,523,607 I218K probably benign Het
Npy2r T C 3: 82,541,049 T140A probably damaging Het
Nr2e1 T A 10: 42,563,472 L350F probably damaging Het
Nup210l C T 3: 90,199,866 P1570L probably benign Het
Olfr1489 G T 19: 13,633,283 M57I probably damaging Het
Olfr469 A C 7: 107,822,605 L288W probably damaging Het
Olfr557 A T 7: 102,698,447 M70L probably damaging Het
Pabpc1l G T 2: 164,025,503 C8F probably benign Het
Pafah1b3 A C 7: 25,295,274 F172V probably benign Het
Pcdhga6 A T 18: 37,708,318 T364S probably damaging Het
Ppp3cc T A 14: 70,224,992 M399L probably benign Het
Prpsap2 T C 11: 61,744,956 I173V probably benign Het
Rabggtb A T 3: 153,908,180 W252R probably damaging Het
Raph1 A G 1: 60,501,800 F351L unknown Het
Rasd2 T C 8: 75,221,961 S172P probably damaging Het
Rbm15 T C 3: 107,331,436 T549A probably benign Het
Reln A G 5: 22,344,204 Y69H possibly damaging Het
Samd3 T A 10: 26,271,745 N439K probably benign Het
Scap C A 9: 110,378,771 A516D probably damaging Het
Selplg T C 5: 113,819,856 T130A probably benign Het
Slc12a7 A G 13: 73,800,944 M697V probably benign Het
Slc22a29 A G 19: 8,218,477 I66T probably benign Het
Snrnp48 A C 13: 38,220,691 I241L probably damaging Het
Sptb C T 12: 76,587,518 E2140K probably benign Het
Strip2 T C 6: 29,927,334 S192P probably benign Het
Svil A T 18: 5,099,013 R1643S probably benign Het
Tbc1d2b A G 9: 90,219,086 V617A possibly damaging Het
Tmem102 T C 11: 69,804,315 E277G probably benign Het
Tmtc4 T G 14: 122,926,029 I648L probably benign Het
Togaram1 T C 12: 64,967,430 V485A probably damaging Het
Trim43b T C 9: 89,087,589 I269V probably benign Het
Trpm2 T A 10: 77,911,357 I1436F possibly damaging Het
Ube2d3 A T 3: 135,462,961 I106F possibly damaging Het
Vdr G A 15: 97,857,452 R397C probably damaging Het
Vps50 T C 6: 3,592,433 S689P probably benign Het
Wipf2 A G 11: 98,896,242 T366A probably damaging Het
Zfp128 T C 7: 12,890,970 Y422H possibly damaging Het
Zfyve28 G A 5: 34,216,588 T694I probably benign Het
Other mutations in Dnah17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Dnah17 APN 11 118088214 missense possibly damaging 0.81
IGL00531:Dnah17 APN 11 118043173 missense probably damaging 0.97
IGL00764:Dnah17 APN 11 118096485 missense probably damaging 0.99
IGL00795:Dnah17 APN 11 118093634 missense probably benign 0.35
IGL00823:Dnah17 APN 11 118047161 missense probably benign 0.22
IGL01145:Dnah17 APN 11 118047173 missense possibly damaging 0.63
IGL01433:Dnah17 APN 11 118049934 missense probably damaging 1.00
IGL01454:Dnah17 APN 11 118058397 missense probably damaging 1.00
IGL01545:Dnah17 APN 11 118119568 missense probably damaging 1.00
IGL01548:Dnah17 APN 11 118098612 missense probably benign 0.21
IGL01557:Dnah17 APN 11 118073686 missense probably damaging 0.98
IGL01632:Dnah17 APN 11 118033881 missense probably damaging 1.00
IGL01636:Dnah17 APN 11 118041056 missense probably benign 0.03
IGL01672:Dnah17 APN 11 118042160 missense probably damaging 0.97
IGL01822:Dnah17 APN 11 118081993 missense probably damaging 1.00
IGL01869:Dnah17 APN 11 118052676 missense probably benign 0.09
IGL01916:Dnah17 APN 11 118125288 missense probably benign 0.00
IGL02131:Dnah17 APN 11 118072908 missense probably damaging 1.00
IGL02154:Dnah17 APN 11 118124261 missense probably benign 0.01
IGL02220:Dnah17 APN 11 118072967 nonsense probably null
IGL02454:Dnah17 APN 11 118080767 missense probably damaging 0.98
IGL02458:Dnah17 APN 11 118036350 missense probably damaging 1.00
IGL02588:Dnah17 APN 11 118025653 missense possibly damaging 0.95
IGL02865:Dnah17 APN 11 118073548 missense probably damaging 1.00
IGL02881:Dnah17 APN 11 118042118 missense probably damaging 1.00
IGL02952:Dnah17 APN 11 118088268 missense probably benign 0.03
IGL03382:Dnah17 APN 11 118081943 missense probably damaging 1.00
IGL03389:Dnah17 APN 11 118094979 missense probably damaging 1.00
ergos UTSW 11 118041158 splice site probably benign
watt UTSW 11 118080766 missense probably damaging 0.96
PIT4280001:Dnah17 UTSW 11 118098582 missense possibly damaging 0.85
R0004:Dnah17 UTSW 11 118060092 missense possibly damaging 0.90
R0112:Dnah17 UTSW 11 118074434 missense possibly damaging 0.82
R0116:Dnah17 UTSW 11 118058306 missense probably benign 0.01
R0157:Dnah17 UTSW 11 118127171 missense probably benign
R0320:Dnah17 UTSW 11 118052674 missense possibly damaging 0.56
R0362:Dnah17 UTSW 11 118098539 missense probably benign 0.10
R0382:Dnah17 UTSW 11 118128996 missense probably damaging 1.00
R0383:Dnah17 UTSW 11 118067547 missense probably benign
R0400:Dnah17 UTSW 11 118082078 missense probably damaging 1.00
R0420:Dnah17 UTSW 11 118039939 missense probably damaging 1.00
R0483:Dnah17 UTSW 11 118047124 missense probably benign
R0533:Dnah17 UTSW 11 118110537 missense possibly damaging 0.50
R0562:Dnah17 UTSW 11 118072900 missense probably damaging 1.00
R0564:Dnah17 UTSW 11 118082981 missense probably damaging 1.00
R0604:Dnah17 UTSW 11 118121471 missense probably benign 0.00
R0608:Dnah17 UTSW 11 118090749 nonsense probably null
R0614:Dnah17 UTSW 11 118070568 splice site probably benign
R0632:Dnah17 UTSW 11 118067682 splice site probably benign
R0831:Dnah17 UTSW 11 118060271 missense probably damaging 0.99
R0838:Dnah17 UTSW 11 118060104 missense probably damaging 1.00
R0879:Dnah17 UTSW 11 118056835 splice site probably benign
R1061:Dnah17 UTSW 11 118052688 missense possibly damaging 0.51
R1190:Dnah17 UTSW 11 118042175 missense probably damaging 1.00
R1293:Dnah17 UTSW 11 118127137 critical splice donor site probably null
R1297:Dnah17 UTSW 11 118121366 splice site probably benign
R1332:Dnah17 UTSW 11 118043215 missense possibly damaging 0.70
R1336:Dnah17 UTSW 11 118043215 missense possibly damaging 0.70
R1364:Dnah17 UTSW 11 118125606 splice site probably benign
R1418:Dnah17 UTSW 11 118074023 missense probably damaging 0.98
R1432:Dnah17 UTSW 11 118023327 missense probably damaging 1.00
R1497:Dnah17 UTSW 11 118114233 missense probably damaging 1.00
R1500:Dnah17 UTSW 11 118101053 missense probably benign
R1506:Dnah17 UTSW 11 118125387 missense possibly damaging 0.53
R1512:Dnah17 UTSW 11 118095015 missense probably benign
R1567:Dnah17 UTSW 11 118125985 missense probably damaging 1.00
R1597:Dnah17 UTSW 11 118103498 splice site probably benign
R1665:Dnah17 UTSW 11 118121495 splice site probably benign
R1703:Dnah17 UTSW 11 118026749 missense probably damaging 1.00
R1716:Dnah17 UTSW 11 118032598 missense probably benign 0.00
R1727:Dnah17 UTSW 11 118070489 missense probably damaging 0.98
R1727:Dnah17 UTSW 11 118096536 nonsense probably null
R1728:Dnah17 UTSW 11 118069519 missense possibly damaging 0.76
R1784:Dnah17 UTSW 11 118069519 missense possibly damaging 0.76
R1852:Dnah17 UTSW 11 118121916 missense probably damaging 0.97
R1869:Dnah17 UTSW 11 118047189 nonsense probably null
R1886:Dnah17 UTSW 11 118108161 missense possibly damaging 0.62
R1893:Dnah17 UTSW 11 118066968 missense probably benign 0.00
R1954:Dnah17 UTSW 11 118024731 missense probably damaging 1.00
R1969:Dnah17 UTSW 11 118104535 missense probably benign 0.00
R1971:Dnah17 UTSW 11 118104535 missense probably benign 0.00
R1975:Dnah17 UTSW 11 118096536 nonsense probably null
R1977:Dnah17 UTSW 11 118112591 missense possibly damaging 0.52
R2055:Dnah17 UTSW 11 118067531 missense probably benign 0.00
R2115:Dnah17 UTSW 11 118119802 missense probably benign 0.00
R2132:Dnah17 UTSW 11 118033747 missense probably damaging 0.98
R2200:Dnah17 UTSW 11 118102409 splice site probably benign
R2277:Dnah17 UTSW 11 118096561 missense possibly damaging 0.81
R2279:Dnah17 UTSW 11 118096561 missense possibly damaging 0.81
R2400:Dnah17 UTSW 11 118126384 critical splice acceptor site probably null
R2402:Dnah17 UTSW 11 118125974 missense probably benign 0.10
R2497:Dnah17 UTSW 11 118087024 splice site probably null
R2923:Dnah17 UTSW 11 118093547 missense probably damaging 1.00
R3121:Dnah17 UTSW 11 118041086 missense probably damaging 1.00
R3236:Dnah17 UTSW 11 118094854 missense probably benign 0.08
R3237:Dnah17 UTSW 11 118094854 missense probably benign 0.08
R3498:Dnah17 UTSW 11 118080849 splice site probably benign
R3499:Dnah17 UTSW 11 118080849 splice site probably benign
R3746:Dnah17 UTSW 11 118082916 missense probably benign 0.00
R3749:Dnah17 UTSW 11 118082916 missense probably benign 0.00
R3762:Dnah17 UTSW 11 118104526 missense probably benign 0.00
R3826:Dnah17 UTSW 11 118041158 splice site probably benign
R3828:Dnah17 UTSW 11 118041158 splice site probably benign
R3829:Dnah17 UTSW 11 118041158 splice site probably benign
R3877:Dnah17 UTSW 11 118024707 missense probably damaging 1.00
R3899:Dnah17 UTSW 11 118094808 missense possibly damaging 0.78
R3900:Dnah17 UTSW 11 118094808 missense possibly damaging 0.78
R3911:Dnah17 UTSW 11 118080849 splice site probably benign
R3913:Dnah17 UTSW 11 118080849 splice site probably benign
R3930:Dnah17 UTSW 11 118080849 splice site probably benign
R3931:Dnah17 UTSW 11 118080849 splice site probably benign
R3969:Dnah17 UTSW 11 118041158 splice site probably benign
R3970:Dnah17 UTSW 11 118041158 splice site probably benign
R4056:Dnah17 UTSW 11 118070538 missense probably benign 0.05
R4113:Dnah17 UTSW 11 118112594 missense possibly damaging 0.50
R4295:Dnah17 UTSW 11 118118772 missense probably damaging 1.00
R4324:Dnah17 UTSW 11 118094213 missense probably benign 0.01
R4412:Dnah17 UTSW 11 118073683 missense probably damaging 1.00
R4413:Dnah17 UTSW 11 118025168 missense probably benign 0.00
R4422:Dnah17 UTSW 11 118081973 missense possibly damaging 0.91
R4552:Dnah17 UTSW 11 118052943 missense possibly damaging 0.79
R4669:Dnah17 UTSW 11 118074293 missense probably benign 0.02
R4677:Dnah17 UTSW 11 118119814 missense probably damaging 1.00
R4716:Dnah17 UTSW 11 118073648 missense probably benign 0.02
R4832:Dnah17 UTSW 11 118026780 missense probably damaging 1.00
R4868:Dnah17 UTSW 11 118108212 missense probably benign 0.03
R4897:Dnah17 UTSW 11 118078593 missense probably damaging 1.00
R4928:Dnah17 UTSW 11 118027433 missense probably damaging 1.00
R4937:Dnah17 UTSW 11 118042154 missense probably damaging 1.00
R4957:Dnah17 UTSW 11 118074298 missense probably benign 0.44
R5008:Dnah17 UTSW 11 118110577 missense probably benign 0.01
R5016:Dnah17 UTSW 11 118080766 missense probably damaging 0.96
R5027:Dnah17 UTSW 11 118102539 missense probably benign 0.01
R5133:Dnah17 UTSW 11 118117113 missense probably benign 0.00
R5140:Dnah17 UTSW 11 118086945 missense probably damaging 1.00
R5146:Dnah17 UTSW 11 118114179 missense probably damaging 0.99
R5151:Dnah17 UTSW 11 118027467 missense probably damaging 1.00
R5153:Dnah17 UTSW 11 118082974 nonsense probably null
R5192:Dnah17 UTSW 11 118034359 missense possibly damaging 0.96
R5315:Dnah17 UTSW 11 118127283 missense possibly damaging 0.79
R5317:Dnah17 UTSW 11 118127283 missense possibly damaging 0.79
R5335:Dnah17 UTSW 11 118112514 missense probably damaging 1.00
R5379:Dnah17 UTSW 11 118117203 intron probably benign
R5396:Dnah17 UTSW 11 118127282 missense probably benign
R5418:Dnah17 UTSW 11 118094984 missense probably benign 0.04
R5534:Dnah17 UTSW 11 118052770 missense possibly damaging 0.83
R5539:Dnah17 UTSW 11 118073660 missense probably benign 0.03
R5594:Dnah17 UTSW 11 118043229 splice site probably null
R5634:Dnah17 UTSW 11 118052926 splice site probably null
R5696:Dnah17 UTSW 11 118101056 missense probably benign 0.44
R5802:Dnah17 UTSW 11 118036446 missense possibly damaging 0.79
R5826:Dnah17 UTSW 11 118034367 missense probably damaging 1.00
R5873:Dnah17 UTSW 11 118056897 missense probably benign 0.01
R5898:Dnah17 UTSW 11 118114213 missense probably benign 0.00
R5934:Dnah17 UTSW 11 118041102 missense probably benign
R6030:Dnah17 UTSW 11 118025549 missense probably benign 0.32
R6030:Dnah17 UTSW 11 118025549 missense probably benign 0.32
R6038:Dnah17 UTSW 11 118055889 missense probably benign 0.00
R6038:Dnah17 UTSW 11 118055889 missense probably benign 0.00
R6113:Dnah17 UTSW 11 118126275 missense probably damaging 1.00
R6117:Dnah17 UTSW 11 118119571 missense probably benign 0.00
R6137:Dnah17 UTSW 11 118025654 missense probably damaging 1.00
R6173:Dnah17 UTSW 11 118039946 missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118126322 missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118126323 nonsense probably null
R6258:Dnah17 UTSW 11 118126324 missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118126322 missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118126323 nonsense probably null
R6260:Dnah17 UTSW 11 118126324 missense probably damaging 1.00
R6278:Dnah17 UTSW 11 118126290 missense probably damaging 0.99
R6298:Dnah17 UTSW 11 118108161 missense probably benign 0.00
R6300:Dnah17 UTSW 11 118034310 missense probably damaging 1.00
R6302:Dnah17 UTSW 11 118129155 missense probably benign 0.09
R6363:Dnah17 UTSW 11 118110505 missense probably benign
R6381:Dnah17 UTSW 11 118129185 missense probably benign 0.08
R6418:Dnah17 UTSW 11 118129197 missense probably damaging 0.99
R6660:Dnah17 UTSW 11 118100188 missense probably benign
R6803:Dnah17 UTSW 11 118125372 missense probably benign 0.00
R6820:Dnah17 UTSW 11 118069000 missense probably damaging 0.99
R6885:Dnah17 UTSW 11 118090772 missense possibly damaging 0.47
R6921:Dnah17 UTSW 11 118041484 missense probably damaging 0.98
R6932:Dnah17 UTSW 11 118060079 missense possibly damaging 0.95
R6954:Dnah17 UTSW 11 118066432 missense probably damaging 1.00
R7000:Dnah17 UTSW 11 118025702 critical splice acceptor site probably null
R7007:Dnah17 UTSW 11 118118871 missense possibly damaging 0.92
R7048:Dnah17 UTSW 11 118046118 missense possibly damaging 0.80
R7056:Dnah17 UTSW 11 118125386 missense probably benign
R7131:Dnah17 UTSW 11 118079658 missense probably benign 0.14
R7143:Dnah17 UTSW 11 118086130 missense probably damaging 1.00
R7146:Dnah17 UTSW 11 118082110 missense probably damaging 0.98
R7147:Dnah17 UTSW 11 118094929 missense probably benign 0.31
R7172:Dnah17 UTSW 11 118041131 nonsense probably null
R7183:Dnah17 UTSW 11 118129188 missense probably benign
R7297:Dnah17 UTSW 11 118055730 critical splice donor site probably null
R7297:Dnah17 UTSW 11 118103356 missense probably damaging 0.98
R7367:Dnah17 UTSW 11 118115196 missense probably benign
R7398:Dnah17 UTSW 11 118080724 missense probably damaging 0.96
R7426:Dnah17 UTSW 11 118090717 missense probably null 0.79
R7524:Dnah17 UTSW 11 118121481 missense probably benign 0.03
R7529:Dnah17 UTSW 11 118049866 critical splice donor site probably null
R7615:Dnah17 UTSW 11 118110547 nonsense probably null
R7681:Dnah17 UTSW 11 118025186 missense probably damaging 1.00
R7702:Dnah17 UTSW 11 118025640 missense probably benign 0.00
R7702:Dnah17 UTSW 11 118121478 missense possibly damaging 0.64
R7713:Dnah17 UTSW 11 118025171 missense probably benign 0.02
R7809:Dnah17 UTSW 11 118104636 missense probably benign 0.09
R7842:Dnah17 UTSW 11 118079682 critical splice acceptor site probably null
R7935:Dnah17 UTSW 11 118127222 missense probably benign 0.20
R7951:Dnah17 UTSW 11 118118766 missense possibly damaging 0.64
R8070:Dnah17 UTSW 11 118024671 missense probably damaging 0.97
R8098:Dnah17 UTSW 11 118050367 missense probably damaging 1.00
R8101:Dnah17 UTSW 11 118125918 missense probably benign
R8177:Dnah17 UTSW 11 118128927 missense possibly damaging 0.60
R8343:Dnah17 UTSW 11 118114195 missense probably benign
R8350:Dnah17 UTSW 11 118087047 missense probably damaging 0.98
R8393:Dnah17 UTSW 11 118057029 missense probably damaging 1.00
R8401:Dnah17 UTSW 11 118024659 missense probably damaging 0.96
R8418:Dnah17 UTSW 11 118103458 missense probably benign 0.01
R8450:Dnah17 UTSW 11 118087047 missense probably damaging 0.98
R8546:Dnah17 UTSW 11 118124275 missense probably benign 0.00
R8697:Dnah17 UTSW 11 118086159 missense possibly damaging 0.96
R8710:Dnah17 UTSW 11 118042147 missense probably damaging 1.00
R8713:Dnah17 UTSW 11 118088202 missense probably damaging 1.00
R8722:Dnah17 UTSW 11 118070457 nonsense probably null
R8797:Dnah17 UTSW 11 118101375 missense probably benign 0.00
R8953:Dnah17 UTSW 11 118125412 splice site probably benign
R8965:Dnah17 UTSW 11 118024666 missense probably damaging 1.00
R8976:Dnah17 UTSW 11 118026840 missense probably damaging 1.00
R9090:Dnah17 UTSW 11 118041044 missense probably damaging 1.00
R9128:Dnah17 UTSW 11 118046178 missense possibly damaging 0.76
R9134:Dnah17 UTSW 11 118088146 missense probably damaging 1.00
R9245:Dnah17 UTSW 11 118125677 missense probably benign 0.02
R9251:Dnah17 UTSW 11 118121792 missense probably benign 0.03
R9271:Dnah17 UTSW 11 118041044 missense probably damaging 1.00
R9367:Dnah17 UTSW 11 118096638 missense possibly damaging 0.95
R9367:Dnah17 UTSW 11 118121386 missense possibly damaging 0.93
R9405:Dnah17 UTSW 11 118118911 missense probably benign
R9449:Dnah17 UTSW 11 118096626 missense probably benign 0.07
X0058:Dnah17 UTSW 11 118082925 missense probably damaging 1.00
Z1176:Dnah17 UTSW 11 118127166 missense probably benign 0.01
Z1177:Dnah17 UTSW 11 118078563 missense possibly damaging 0.91
Z1177:Dnah17 UTSW 11 118086960 missense probably damaging 1.00
Z1177:Dnah17 UTSW 11 118127142 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCGGCCTAGTCACACTGTAG -3'
(R):5'- ACTGGCCTGTCTCTGAAAAG -3'

Sequencing Primer
(F):5'- CTAGTCACACTGTAGGTAGGGCTAC -3'
(R):5'- TTTTTCACGGTCAGCATCCAAACAG -3'
Posted On 2022-04-18