Mutagenetix > Incidental Mutations

Incidental Mutation 'R9381:Afg3l2'

710071

Institutional Source

Beutler Lab

Gene Symbol

Afg3l2

Ensembl Gene

ENSMUSG00000024527

Gene Name

AFG3-like AAA ATPase 2

Synonyms

2310036I02Rik, Emv66, par

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9381 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

67404767-67449166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 67442381 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 74 (E74A)

Ref Sequence

ENSEMBL: ENSMUSP00000025408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025408]

AlphaFold

Q8JZQ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000025408
AA Change: E74A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: E74A

Domain	Start	End	E-Value	Type
low complexity region	95	121	N/A	INTRINSIC
Pfam:FtsH_ext	144	241	8.8e-12	PFAM
transmembrane domain	251	270	N/A	INTRINSIC
low complexity region	271	286	N/A	INTRINSIC
AAA	339	478	1.37e-23	SMART
Pfam:Peptidase_M41	540	743	4e-77	PFAM
low complexity region	780	794	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002D01Rik	CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	7: 29,247,623		probably benign	Het
9930111J21Rik1	T	A	11: 48,948,377	K461M	probably damaging	Het
Abhd16b	A	G	2: 181,494,088	Y261C	probably damaging	Het
Acadl	T	C	1: 66,854,646	T117A	probably benign	Het
Adamts15	A	G	9: 30,902,520	V783A	probably damaging	Het
Aff1	A	T	5: 103,833,867	Q624L	possibly damaging	Het
Aig1	T	C	10: 13,647,673	E238G	probably benign	Het
Ankrd17	C	T	5: 90,268,649	R1108Q	probably damaging	Het
Anks1	A	T	17: 28,054,005	Y958F	probably damaging	Het
Arhgef28	C	A	13: 97,899,761	Q1663H	possibly damaging	Het
Asb3	T	C	11: 31,101,088	L475P	probably damaging	Het
Atg9a	T	A	1: 75,186,082	M430L	probably benign	Het
Bco1	T	A	8: 117,110,892	V164E	probably benign	Het
Bhlhe40	T	C	6: 108,665,283	L396P	probably damaging	Het
C5ar2	A	T	7: 16,236,962	S347T	probably damaging	Het
Cdc42bpa	T	C	1: 180,141,483	S1212P	probably damaging	Het
Ceacam3	C	G	7: 17,159,790	Q409E		Het
Ces3b	T	C	8: 105,085,038	V62A	probably benign	Het
Dalrd3	A	G	9: 108,571,043		probably null	Het
Ddhd2	G	T	8: 25,749,822	A288E	probably benign	Het
Dnah17	T	A	11: 118,023,393	M4435L	probably benign	Het
Dok1	T	C	6: 83,032,991	K46E	probably damaging	Het
E030025P04Rik	A	G	11: 109,139,558	Y168H	unknown	Het
Elavl2	T	C	4: 91,308,772	N23S	probably benign	Het
Elfn1	T	C	5: 139,973,707	V822A	probably damaging	Het
Emb	G	T	13: 117,220,560		probably benign	Het
Exoc5	C	T	14: 49,037,737	S202N	probably benign	Het
Fryl	T	C	5: 73,083,294	D1321G	probably benign	Het
Gm12258	C	T	11: 58,859,181	T394I	unknown	Het
Gm28363	T	A	1: 117,726,885	S85T	probably damaging	Het
Gm5724	T	C	6: 141,765,764	I74V	probably benign	Het
H2-Q1	A	G	17: 35,323,162	T237A	probably damaging	Het
Hectd4	A	T	5: 121,334,429	I2743F	possibly damaging	Het
Hs3st3b1	C	T	11: 63,921,866	G8S	probably benign	Het
Ighv1-16	T	C	12: 114,665,978	N63S	probably benign	Het
Il20rb	A	G	9: 100,461,488	F238L	possibly damaging	Het
Il31ra	A	T	13: 112,531,719	F439I	possibly damaging	Het
Jup	C	T	11: 100,379,565	C372Y	probably damaging	Het
Kat2a	T	C	11: 100,711,866	Q132R	possibly damaging	Het
Kcnq2	A	G	2: 181,109,769	I278T	probably damaging	Het
Lama1	T	C	17: 67,737,484	V126A		Het
Lama2	T	A	10: 27,188,027	R1285*	probably null	Het
Larp1	A	G	11: 58,058,706	T1054A	probably benign	Het
Lrp1	A	T	10: 127,605,468	M262K	probably benign	Het
Lrrd1	A	G	5: 3,851,074	I460V	probably benign	Het
Ltbp1	A	T	17: 75,389,439	N1606I	probably damaging	Het
Mdga2	T	C	12: 66,550,530	N730S	possibly damaging	Het
Mpzl1	T	C	1: 165,601,754	H236R	probably damaging	Het
Mrps31	G	A	8: 22,414,736	R47K	probably damaging	Het
Nae1	A	T	8: 104,523,607	I218K	probably benign	Het
Npy2r	T	C	3: 82,541,049	T140A	probably damaging	Het
Nr2e1	T	A	10: 42,563,472	L350F	probably damaging	Het
Nup210l	C	T	3: 90,199,866	P1570L	probably benign	Het
Olfr1489	G	T	19: 13,633,283	M57I	probably damaging	Het
Olfr469	A	C	7: 107,822,605	L288W	probably damaging	Het
Olfr557	A	T	7: 102,698,447	M70L	probably damaging	Het
Pabpc1l	G	T	2: 164,025,503	C8F	probably benign	Het
Pafah1b3	A	C	7: 25,295,274	F172V	probably benign	Het
Pcdhga6	A	T	18: 37,708,318	T364S	probably damaging	Het
Ppp3cc	T	A	14: 70,224,992	M399L	probably benign	Het
Prpsap2	T	C	11: 61,744,956	I173V	probably benign	Het
Rabggtb	A	T	3: 153,908,180	W252R	probably damaging	Het
Raph1	A	G	1: 60,501,800	F351L	unknown	Het
Rasd2	T	C	8: 75,221,961	S172P	probably damaging	Het
Rbm15	T	C	3: 107,331,436	T549A	probably benign	Het
Reln	A	G	5: 22,344,204	Y69H	possibly damaging	Het
Samd3	T	A	10: 26,271,745	N439K	probably benign	Het
Scap	C	A	9: 110,378,771	A516D	probably damaging	Het
Selplg	T	C	5: 113,819,856	T130A	probably benign	Het
Slc12a7	A	G	13: 73,800,944	M697V	probably benign	Het
Slc22a29	A	G	19: 8,218,477	I66T	probably benign	Het
Snrnp48	A	C	13: 38,220,691	I241L	probably damaging	Het
Sptb	C	T	12: 76,587,518	E2140K	probably benign	Het
Strip2	T	C	6: 29,927,334	S192P	probably benign	Het
Svil	A	T	18: 5,099,013	R1643S	probably benign	Het
Tbc1d2b	A	G	9: 90,219,086	V617A	possibly damaging	Het
Tmem102	T	C	11: 69,804,315	E277G	probably benign	Het
Tmtc4	T	G	14: 122,926,029	I648L	probably benign	Het
Togaram1	T	C	12: 64,967,430	V485A	probably damaging	Het
Trim43b	T	C	9: 89,087,589	I269V	probably benign	Het
Trpm2	T	A	10: 77,911,357	I1436F	possibly damaging	Het
Ube2d3	A	T	3: 135,462,961	I106F	possibly damaging	Het
Vdr	G	A	15: 97,857,452	R397C	probably damaging	Het
Vps50	T	C	6: 3,592,433	S689P	probably benign	Het
Wipf2	A	G	11: 98,896,242	T366A	probably damaging	Het
Zfp128	T	C	7: 12,890,970	Y422H	possibly damaging	Het
Zfyve28	G	A	5: 34,216,588	T694I	probably benign	Het

Other mutations in Afg3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00962:Afg3l2	APN	18	67431653	critical splice donor site	probably null
IGL01395:Afg3l2	APN	18	67442810	missense	probably benign	0.21
IGL01533:Afg3l2	APN	18	67405418	nonsense	probably null
IGL01814:Afg3l2	APN	18	67405474	missense	probably benign	0.23
IGL01868:Afg3l2	APN	18	67414148	missense	possibly damaging	0.83
IGL02399:Afg3l2	APN	18	67429040	missense	possibly damaging	0.82
IGL02827:Afg3l2	APN	18	67425945	missense	probably damaging	1.00
IGL03342:Afg3l2	APN	18	67407320	missense	probably benign
IGL03392:Afg3l2	APN	18	67414069	splice site	probably benign
radicle	UTSW	18	67422953	missense	probably damaging	1.00
rootlet	UTSW	18	67421259	missense	probably damaging	1.00
R0057:Afg3l2	UTSW	18	67423086	missense	probably damaging	1.00
R0107:Afg3l2	UTSW	18	67431766	missense	probably damaging	1.00
R0650:Afg3l2	UTSW	18	67415557	missense	possibly damaging	0.77
R0831:Afg3l2	UTSW	18	67421227	missense	probably damaging	1.00
R0899:Afg3l2	UTSW	18	67422977	missense	possibly damaging	0.65
R0962:Afg3l2	UTSW	18	67405427	missense	possibly damaging	0.77
R1672:Afg3l2	UTSW	18	67407423	missense	probably benign	0.31
R1815:Afg3l2	UTSW	18	67415573	nonsense	probably null
R1838:Afg3l2	UTSW	18	67414172	missense	probably damaging	0.99
R2013:Afg3l2	UTSW	18	67431772	missense	probably damaging	0.99
R2383:Afg3l2	UTSW	18	67422956	missense	possibly damaging	0.91
R2906:Afg3l2	UTSW	18	67440222	missense	probably damaging	1.00
R4763:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4765:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4775:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5193:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5196:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5197:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5257:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5361:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5362:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5363:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5397:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5588:Afg3l2	UTSW	18	67440207	missense	possibly damaging	0.88
R5605:Afg3l2	UTSW	18	67442355	nonsense	probably null
R5696:Afg3l2	UTSW	18	67407459	missense	probably damaging	1.00
R5722:Afg3l2	UTSW	18	67440199	missense	probably benign	0.44
R5779:Afg3l2	UTSW	18	67440443	missense	probably null	0.12
R5972:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5973:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5974:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5979:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5994:Afg3l2	UTSW	18	67429070	missense	probably damaging	1.00
R6026:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6027:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6028:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6029:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6075:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6077:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6081:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6131:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6132:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6134:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6152:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6154:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6169:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6178:Afg3l2	UTSW	18	67409528	missense	possibly damaging	0.91
R6187:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6216:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6718:Afg3l2	UTSW	18	67421276	missense	probably damaging	1.00
R7388:Afg3l2	UTSW	18	67422953	missense	probably damaging	1.00
R8479:Afg3l2	UTSW	18	67448916	missense	probably benign	0.05
R8531:Afg3l2	UTSW	18	67407369	missense	probably damaging	0.99
R9017:Afg3l2	UTSW	18	67409480	missense	possibly damaging	0.81
R9220:Afg3l2	UTSW	18	67429196	missense	probably benign
R9222:Afg3l2	UTSW	18	67434187	missense	probably benign	0.05
R9371:Afg3l2	UTSW	18	67434192	missense	possibly damaging	0.84
Z1176:Afg3l2	UTSW	18	67431707	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- CTTCAATGTGTAAAGTGGCAGG -3'
(R):5'- AATTGACACGGCCGGATTGTG -3'

Sequencing Primer
(F):5'- GCCCACTGAACTCTGGCTG -3'
(R):5'- ACGGCCGGATTGTGAACTG -3'

Posted On

2022-04-18