Incidental Mutation 'R9381:Afg3l2'
ID 710071
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene Name AFG3-like AAA ATPase 2
Synonyms 2310036I02Rik, Emv66, par
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9381 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 67404767-67449166 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 67442381 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 74 (E74A)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
AlphaFold Q8JZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000025408
AA Change: E74A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: E74A

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
9930111J21Rik1 T A 11: 48,948,377 K461M probably damaging Het
Abhd16b A G 2: 181,494,088 Y261C probably damaging Het
Acadl T C 1: 66,854,646 T117A probably benign Het
Adamts15 A G 9: 30,902,520 V783A probably damaging Het
Aff1 A T 5: 103,833,867 Q624L possibly damaging Het
Aig1 T C 10: 13,647,673 E238G probably benign Het
Ankrd17 C T 5: 90,268,649 R1108Q probably damaging Het
Anks1 A T 17: 28,054,005 Y958F probably damaging Het
Arhgef28 C A 13: 97,899,761 Q1663H possibly damaging Het
Asb3 T C 11: 31,101,088 L475P probably damaging Het
Atg9a T A 1: 75,186,082 M430L probably benign Het
Bco1 T A 8: 117,110,892 V164E probably benign Het
Bhlhe40 T C 6: 108,665,283 L396P probably damaging Het
C5ar2 A T 7: 16,236,962 S347T probably damaging Het
Cdc42bpa T C 1: 180,141,483 S1212P probably damaging Het
Ceacam3 C G 7: 17,159,790 Q409E Het
Ces3b T C 8: 105,085,038 V62A probably benign Het
Dalrd3 A G 9: 108,571,043 probably null Het
Ddhd2 G T 8: 25,749,822 A288E probably benign Het
Dnah17 T A 11: 118,023,393 M4435L probably benign Het
Dok1 T C 6: 83,032,991 K46E probably damaging Het
E030025P04Rik A G 11: 109,139,558 Y168H unknown Het
Elavl2 T C 4: 91,308,772 N23S probably benign Het
Elfn1 T C 5: 139,973,707 V822A probably damaging Het
Emb G T 13: 117,220,560 probably benign Het
Exoc5 C T 14: 49,037,737 S202N probably benign Het
Fryl T C 5: 73,083,294 D1321G probably benign Het
Gm12258 C T 11: 58,859,181 T394I unknown Het
Gm28363 T A 1: 117,726,885 S85T probably damaging Het
Gm5724 T C 6: 141,765,764 I74V probably benign Het
H2-Q1 A G 17: 35,323,162 T237A probably damaging Het
Hectd4 A T 5: 121,334,429 I2743F possibly damaging Het
Hs3st3b1 C T 11: 63,921,866 G8S probably benign Het
Ighv1-16 T C 12: 114,665,978 N63S probably benign Het
Il20rb A G 9: 100,461,488 F238L possibly damaging Het
Il31ra A T 13: 112,531,719 F439I possibly damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kat2a T C 11: 100,711,866 Q132R possibly damaging Het
Kcnq2 A G 2: 181,109,769 I278T probably damaging Het
Lama1 T C 17: 67,737,484 V126A Het
Lama2 T A 10: 27,188,027 R1285* probably null Het
Larp1 A G 11: 58,058,706 T1054A probably benign Het
Lrp1 A T 10: 127,605,468 M262K probably benign Het
Lrrd1 A G 5: 3,851,074 I460V probably benign Het
Ltbp1 A T 17: 75,389,439 N1606I probably damaging Het
Mdga2 T C 12: 66,550,530 N730S possibly damaging Het
Mpzl1 T C 1: 165,601,754 H236R probably damaging Het
Mrps31 G A 8: 22,414,736 R47K probably damaging Het
Nae1 A T 8: 104,523,607 I218K probably benign Het
Npy2r T C 3: 82,541,049 T140A probably damaging Het
Nr2e1 T A 10: 42,563,472 L350F probably damaging Het
Nup210l C T 3: 90,199,866 P1570L probably benign Het
Olfr1489 G T 19: 13,633,283 M57I probably damaging Het
Olfr469 A C 7: 107,822,605 L288W probably damaging Het
Olfr557 A T 7: 102,698,447 M70L probably damaging Het
Pabpc1l G T 2: 164,025,503 C8F probably benign Het
Pafah1b3 A C 7: 25,295,274 F172V probably benign Het
Pcdhga6 A T 18: 37,708,318 T364S probably damaging Het
Ppp3cc T A 14: 70,224,992 M399L probably benign Het
Prpsap2 T C 11: 61,744,956 I173V probably benign Het
Rabggtb A T 3: 153,908,180 W252R probably damaging Het
Raph1 A G 1: 60,501,800 F351L unknown Het
Rasd2 T C 8: 75,221,961 S172P probably damaging Het
Rbm15 T C 3: 107,331,436 T549A probably benign Het
Reln A G 5: 22,344,204 Y69H possibly damaging Het
Samd3 T A 10: 26,271,745 N439K probably benign Het
Scap C A 9: 110,378,771 A516D probably damaging Het
Selplg T C 5: 113,819,856 T130A probably benign Het
Slc12a7 A G 13: 73,800,944 M697V probably benign Het
Slc22a29 A G 19: 8,218,477 I66T probably benign Het
Snrnp48 A C 13: 38,220,691 I241L probably damaging Het
Sptb C T 12: 76,587,518 E2140K probably benign Het
Strip2 T C 6: 29,927,334 S192P probably benign Het
Svil A T 18: 5,099,013 R1643S probably benign Het
Tbc1d2b A G 9: 90,219,086 V617A possibly damaging Het
Tmem102 T C 11: 69,804,315 E277G probably benign Het
Tmtc4 T G 14: 122,926,029 I648L probably benign Het
Togaram1 T C 12: 64,967,430 V485A probably damaging Het
Trim43b T C 9: 89,087,589 I269V probably benign Het
Trpm2 T A 10: 77,911,357 I1436F possibly damaging Het
Ube2d3 A T 3: 135,462,961 I106F possibly damaging Het
Vdr G A 15: 97,857,452 R397C probably damaging Het
Vps50 T C 6: 3,592,433 S689P probably benign Het
Wipf2 A G 11: 98,896,242 T366A probably damaging Het
Zfp128 T C 7: 12,890,970 Y422H possibly damaging Het
Zfyve28 G A 5: 34,216,588 T694I probably benign Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67421227 missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67422953 missense probably damaging 1.00
R8479:Afg3l2 UTSW 18 67448916 missense probably benign 0.05
R8531:Afg3l2 UTSW 18 67407369 missense probably damaging 0.99
R9017:Afg3l2 UTSW 18 67409480 missense possibly damaging 0.81
R9220:Afg3l2 UTSW 18 67429196 missense probably benign
R9222:Afg3l2 UTSW 18 67434187 missense probably benign 0.05
R9371:Afg3l2 UTSW 18 67434192 missense possibly damaging 0.84
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CTTCAATGTGTAAAGTGGCAGG -3'
(R):5'- AATTGACACGGCCGGATTGTG -3'

Sequencing Primer
(F):5'- GCCCACTGAACTCTGGCTG -3'
(R):5'- ACGGCCGGATTGTGAACTG -3'
Posted On 2022-04-18