Incidental Mutation 'R9382:Fkbp15'
ID 710089
Institutional Source Beutler Lab
Gene Symbol Fkbp15
Ensembl Gene ENSMUSG00000066151
Gene Name FK506 binding protein 15
Synonyms FKBP133, C430014M02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9382 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 62300342-62360548 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62318973 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 635 (L635H)
Ref Sequence ENSEMBL: ENSMUSP00000095641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084527] [ENSMUST00000084528] [ENSMUST00000098033] [ENSMUST00000107461]
AlphaFold Q6P9Q6
Predicted Effect probably benign
Transcript: ENSMUST00000084527
SMART Domains Protein: ENSMUSP00000081575
Gene: ENSMUSG00000066151

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 4.8e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.88e-10 PROSPERO
internal_repeat_1 472 500 1.88e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 790 N/A INTRINSIC
coiled coil region 816 865 N/A INTRINSIC
coiled coil region 916 943 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 983 994 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084528
SMART Domains Protein: ENSMUSP00000081576
Gene: ENSMUSG00000066151

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 2.4e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 2.74e-10 PROSPERO
internal_repeat_1 472 500 2.74e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 745 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098033
AA Change: L635H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095641
Gene: ENSMUSG00000066151
AA Change: L635H

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 1.9e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.79e-8 PROSPERO
internal_repeat_1 472 500 1.79e-8 PROSPERO
coiled coil region 560 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107461
SMART Domains Protein: ENSMUSP00000103085
Gene: ENSMUSG00000066151

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 2e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.86e-8 PROSPERO
internal_repeat_1 472 500 1.86e-8 PROSPERO
coiled coil region 560 608 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,930,364 K99N probably benign Het
Abca8b G A 11: 109,979,885 S147L probably benign Het
Abraxas1 A G 5: 100,809,783 V190A probably benign Het
Aox1 T A 1: 58,065,342 H559Q possibly damaging Het
Arhgap31 C T 16: 38,602,626 G1026D probably benign Het
C1ra T C 6: 124,513,860 F71L probably benign Het
C530025M09Rik T C 2: 149,830,720 H165R unknown Het
Celf2 A T 2: 6,721,593 M43K probably damaging Het
Celsr3 T C 9: 108,829,762 V1148A possibly damaging Het
Cmya5 T G 13: 93,093,376 K1735Q probably benign Het
Cntln A C 4: 85,050,081 M846L probably benign Het
Cntn5 T C 9: 9,673,812 T762A probably benign Het
Col11a1 T A 3: 114,105,397 L525Q unknown Het
Col12a1 T C 9: 79,682,082 T1064A probably benign Het
Cyc1 T C 15: 76,345,073 V211A possibly damaging Het
Ddx56 A G 11: 6,265,516 S296P probably damaging Het
Deptor A T 15: 55,112,402 probably benign Het
Ezh1 C T 11: 101,203,439 R409H possibly damaging Het
Fam228b T A 12: 4,748,147 E190V probably damaging Het
Frem1 G A 4: 82,983,385 L969F possibly damaging Het
Gabrg2 T C 11: 41,967,606 R232G probably benign Het
Gpr26 G A 7: 131,967,234 D103N probably damaging Het
Grid2ip T G 5: 143,375,348 probably null Het
Ints7 T C 1: 191,619,681 V834A probably damaging Het
Kcnh7 T A 2: 62,837,268 H309L probably benign Het
Mael T C 1: 166,225,713 E241G probably damaging Het
Neb T A 2: 52,232,265 E584V Het
Nexn C T 3: 152,253,764 V23M probably damaging Het
Npas1 T C 7: 16,456,306 probably null Het
Olfr566 T C 7: 102,856,807 I158M probably benign Het
Pcdh17 T G 14: 84,448,082 V663G probably damaging Het
Pga5 C T 19: 10,669,533 G303S probably damaging Het
Poln T A 5: 34,007,498 K844N probably damaging Het
Prkar1b C T 5: 139,050,687 D227N probably damaging Het
Proc T A 18: 32,123,283 I444F probably damaging Het
Ptprn G T 1: 75,252,491 H791N probably benign Het
Ror1 T C 4: 100,334,512 S160P probably benign Het
Satb2 T A 1: 56,831,638 probably null Het
Slc43a3 C T 2: 84,950,427 A332V probably benign Het
Sp100 G A 1: 85,699,615 V410M probably damaging Het
Srgap2 T C 1: 131,289,608 T989A probably benign Het
Ssc5d T C 7: 4,927,284 probably null Het
Tll2 A G 19: 41,128,558 Y273H probably benign Het
Tub T C 7: 109,027,004 V295A possibly damaging Het
Unc13b T A 4: 43,172,512 D1113E unknown Het
Usp9y C A Y: 1,364,776 M1012I probably benign Het
Vmn1r238 A G 18: 3,122,676 V246A probably damaging Het
Vmn2r88 T G 14: 51,418,740 V802G Het
Wnt7b T C 15: 85,558,974 Q76R probably damaging Het
Zan T C 5: 137,391,655 R4852G unknown Het
Zfp618 A T 4: 63,133,021 T680S probably damaging Het
Zfp784 T A 7: 5,038,339 D25V unknown Het
Other mutations in Fkbp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Fkbp15 APN 4 62333680 splice site probably benign
IGL01326:Fkbp15 APN 4 62323250 missense probably damaging 0.98
IGL01822:Fkbp15 APN 4 62352504 missense probably benign
IGL01925:Fkbp15 APN 4 62323213 missense probably damaging 1.00
IGL02190:Fkbp15 APN 4 62304822 missense possibly damaging 0.69
IGL02276:Fkbp15 APN 4 62336466 nonsense probably null
IGL02310:Fkbp15 APN 4 62340316 missense probably damaging 1.00
IGL02954:Fkbp15 APN 4 62321065 splice site probably benign
IGL02967:Fkbp15 APN 4 62304390 missense probably damaging 0.96
IGL03136:Fkbp15 APN 4 62340229 splice site probably benign
IGL03185:Fkbp15 APN 4 62332186 splice site probably null
IGL03280:Fkbp15 APN 4 62303267 unclassified probably benign
dura UTSW 4 62324126 missense probably damaging 0.96
mater UTSW 4 62326136 missense probably benign 0.22
R0419:Fkbp15 UTSW 4 62326136 missense probably benign 0.22
R0838:Fkbp15 UTSW 4 62324126 missense probably damaging 0.96
R1241:Fkbp15 UTSW 4 62304609 missense possibly damaging 0.87
R1394:Fkbp15 UTSW 4 62327872 missense probably benign 0.00
R1622:Fkbp15 UTSW 4 62323202 missense possibly damaging 0.94
R1682:Fkbp15 UTSW 4 62324194 missense probably damaging 0.98
R1823:Fkbp15 UTSW 4 62337091 missense probably damaging 1.00
R1994:Fkbp15 UTSW 4 62304381 missense probably benign 0.00
R2132:Fkbp15 UTSW 4 62327899 missense probably damaging 1.00
R2133:Fkbp15 UTSW 4 62327899 missense probably damaging 1.00
R2425:Fkbp15 UTSW 4 62312365 missense probably benign 0.00
R2938:Fkbp15 UTSW 4 62304663 missense probably benign 0.23
R3034:Fkbp15 UTSW 4 62306892 splice site probably null
R3957:Fkbp15 UTSW 4 62334252 missense probably benign 0.01
R3963:Fkbp15 UTSW 4 62340677 missense probably damaging 1.00
R4235:Fkbp15 UTSW 4 62336456 missense probably benign 0.38
R4334:Fkbp15 UTSW 4 62303219 missense possibly damaging 0.95
R4366:Fkbp15 UTSW 4 62336414 missense probably benign 0.38
R4717:Fkbp15 UTSW 4 62308069 missense probably damaging 1.00
R4790:Fkbp15 UTSW 4 62307997 missense probably benign 0.05
R5075:Fkbp15 UTSW 4 62321029 missense probably damaging 0.96
R5176:Fkbp15 UTSW 4 62312323 missense possibly damaging 0.68
R5419:Fkbp15 UTSW 4 62327877 missense probably damaging 0.98
R5503:Fkbp15 UTSW 4 62327887 missense probably benign 0.05
R5731:Fkbp15 UTSW 4 62306929 missense probably benign 0.01
R5733:Fkbp15 UTSW 4 62306929 missense probably benign 0.01
R5820:Fkbp15 UTSW 4 62345546 missense probably benign 0.00
R5878:Fkbp15 UTSW 4 62306908 missense probably benign
R5898:Fkbp15 UTSW 4 62326057 critical splice donor site probably null
R5914:Fkbp15 UTSW 4 62327810 splice site probably null
R6113:Fkbp15 UTSW 4 62340647 missense probably benign 0.38
R6377:Fkbp15 UTSW 4 62324192 missense probably damaging 1.00
R6427:Fkbp15 UTSW 4 62323202 missense probably benign 0.01
R6464:Fkbp15 UTSW 4 62308078 missense possibly damaging 0.92
R6528:Fkbp15 UTSW 4 62332270 missense probably damaging 1.00
R6790:Fkbp15 UTSW 4 62304759 missense probably benign 0.01
R6880:Fkbp15 UTSW 4 62336495 missense possibly damaging 0.71
R6911:Fkbp15 UTSW 4 62340290 missense probably damaging 1.00
R7371:Fkbp15 UTSW 4 62321056 missense possibly damaging 0.89
R7410:Fkbp15 UTSW 4 62340299 missense probably damaging 1.00
R7660:Fkbp15 UTSW 4 62314341 missense probably benign 0.08
R7992:Fkbp15 UTSW 4 62312301 missense probably damaging 1.00
R8486:Fkbp15 UTSW 4 62312284 nonsense probably null
R8697:Fkbp15 UTSW 4 62321058 nonsense probably null
R8880:Fkbp15 UTSW 4 62314365 missense probably benign
R8998:Fkbp15 UTSW 4 62324128 missense probably damaging 1.00
R9236:Fkbp15 UTSW 4 62336427 missense probably damaging 0.97
X0013:Fkbp15 UTSW 4 62312370 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- AGAGACTATGACTTGGCAGGTAC -3'
(R):5'- ACTGCATTCATTGTTGTGGC -3'

Sequencing Primer
(F):5'- TGACTTGGCAGGTACTAGAATAC -3'
(R):5'- GTGGCTATCTACTAATGACCTGGTC -3'
Posted On 2022-04-18