Mutagenetix > Incidental Mutation

Incidental Mutation 'R9382:Cntln'

710092

Institutional Source

Beutler Lab

Gene Symbol

Cntln

Ensembl Gene

ENSMUSG00000038070

Gene Name

centlein, centrosomal protein

Synonyms

B430108F07Rik, D530005L17Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.293) question?

Stock #

R9382 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84884309-85131921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 85050081 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 846 (M846L)

Ref Sequence

ENSEMBL: ENSMUSP00000044138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]

AlphaFold

A2AM05

Predicted Effect

probably benign
Transcript: ENSMUST00000047023
AA Change: M846L

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: M846L

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.25e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.25e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	973	1114	N/A	INTRINSIC
low complexity region	1206	1217	N/A	INTRINSIC
Blast:HisKA	1270	1326	1e-24	BLAST
low complexity region	1327	1348	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169371
AA Change: M846L

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: M846L

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.24e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.24e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	972	1113	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
Blast:HisKA	1269	1325	1e-24	BLAST
low complexity region	1326	1347	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,930,364	K99N	probably benign	Het
Abca8b	G	A	11: 109,979,885	S147L	probably benign	Het
Abraxas1	A	G	5: 100,809,783	V190A	probably benign	Het
Aox1	T	A	1: 58,065,342	H559Q	possibly damaging	Het
Arhgap31	C	T	16: 38,602,626	G1026D	probably benign	Het
C1ra	T	C	6: 124,513,860	F71L	probably benign	Het
C530025M09Rik	T	C	2: 149,830,720	H165R	unknown	Het
Celf2	A	T	2: 6,721,593	M43K	probably damaging	Het
Celsr3	T	C	9: 108,829,762	V1148A	possibly damaging	Het
Cmya5	T	G	13: 93,093,376	K1735Q	probably benign	Het
Cntn5	T	C	9: 9,673,812	T762A	probably benign	Het
Col11a1	T	A	3: 114,105,397	L525Q	unknown	Het
Col12a1	T	C	9: 79,682,082	T1064A	probably benign	Het
Cyc1	T	C	15: 76,345,073	V211A	possibly damaging	Het
Ddx56	A	G	11: 6,265,516	S296P	probably damaging	Het
Deptor	A	T	15: 55,112,402		probably benign	Het
Ezh1	C	T	11: 101,203,439	R409H	possibly damaging	Het
Fam228b	T	A	12: 4,748,147	E190V	probably damaging	Het
Fkbp15	A	T	4: 62,318,973	L635H	probably damaging	Het
Frem1	G	A	4: 82,983,385	L969F	possibly damaging	Het
Gabrg2	T	C	11: 41,967,606	R232G	probably benign	Het
Gpr26	G	A	7: 131,967,234	D103N	probably damaging	Het
Grid2ip	T	G	5: 143,375,348		probably null	Het
Ints7	T	C	1: 191,619,681	V834A	probably damaging	Het
Kcnh7	T	A	2: 62,837,268	H309L	probably benign	Het
Mael	T	C	1: 166,225,713	E241G	probably damaging	Het
Neb	T	A	2: 52,232,265	E584V		Het
Nexn	C	T	3: 152,253,764	V23M	probably damaging	Het
Npas1	T	C	7: 16,456,306		probably null	Het
Olfr566	T	C	7: 102,856,807	I158M	probably benign	Het
Pcdh17	T	G	14: 84,448,082	V663G	probably damaging	Het
Pga5	C	T	19: 10,669,533	G303S	probably damaging	Het
Poln	T	A	5: 34,007,498	K844N	probably damaging	Het
Prkar1b	C	T	5: 139,050,687	D227N	probably damaging	Het
Proc	T	A	18: 32,123,283	I444F	probably damaging	Het
Ptprn	G	T	1: 75,252,491	H791N	probably benign	Het
Ror1	T	C	4: 100,334,512	S160P	probably benign	Het
Satb2	T	A	1: 56,831,638		probably null	Het
Slc43a3	C	T	2: 84,950,427	A332V	probably benign	Het
Sp100	G	A	1: 85,699,615	V410M	probably damaging	Het
Srgap2	T	C	1: 131,289,608	T989A	probably benign	Het
Ssc5d	T	C	7: 4,927,284		probably null	Het
Tll2	A	G	19: 41,128,558	Y273H	probably benign	Het
Tub	T	C	7: 109,027,004	V295A	possibly damaging	Het
Unc13b	T	A	4: 43,172,512	D1113E	unknown	Het
Usp9y	C	A	Y: 1,364,776	M1012I	probably benign	Het
Vmn1r238	A	G	18: 3,122,676	V246A	probably damaging	Het
Vmn2r88	T	G	14: 51,418,740	V802G		Het
Wnt7b	T	C	15: 85,558,974	Q76R	probably damaging	Het
Zan	T	C	5: 137,391,655	R4852G	unknown	Het
Zfp618	A	T	4: 63,133,021	T680S	probably damaging	Het
Zfp784	T	A	7: 5,038,339	D25V	unknown	Het

Other mutations in Cntln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Cntln	APN	4	85006434	missense	probably benign	0.25
IGL00743:Cntln	APN	4	84979415	missense	probably benign	0.06
IGL01014:Cntln	APN	4	85049908	missense	probably benign	0.25
IGL02217:Cntln	APN	4	85100258	missense	probably damaging	1.00
IGL02323:Cntln	APN	4	85049789	missense	probably benign	0.00
IGL02353:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02360:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02616:Cntln	APN	4	85115452	critical splice donor site	probably null
PIT4696001:Cntln	UTSW	4	84974000	missense	probably damaging	0.99
R0110:Cntln	UTSW	4	85096757	missense	probably damaging	1.00
R0324:Cntln	UTSW	4	85092695	missense	probably damaging	0.98
R0349:Cntln	UTSW	4	84996485	missense	probably damaging	1.00
R0519:Cntln	UTSW	4	85005053	splice site	probably benign
R0529:Cntln	UTSW	4	85067825	missense	probably damaging	1.00
R0582:Cntln	UTSW	4	84884741	missense	probably damaging	1.00
R1077:Cntln	UTSW	4	84996479	missense	probably damaging	1.00
R1345:Cntln	UTSW	4	84973991	missense	probably damaging	1.00
R1457:Cntln	UTSW	4	85096839	missense	probably benign	0.33
R1571:Cntln	UTSW	4	84947586	nonsense	probably null
R1622:Cntln	UTSW	4	85063181	missense	probably damaging	1.00
R1681:Cntln	UTSW	4	84947635	missense	probably damaging	1.00
R1777:Cntln	UTSW	4	85130679	missense	probably benign	0.23
R1808:Cntln	UTSW	4	85096763	missense	probably damaging	1.00
R1882:Cntln	UTSW	4	85100835	missense	probably damaging	1.00
R2056:Cntln	UTSW	4	85049674	missense	probably benign
R2965:Cntln	UTSW	4	84974027	critical splice donor site	probably null
R2968:Cntln	UTSW	4	84957267	missense	probably benign	0.27
R3104:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3106:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3121:Cntln	UTSW	4	85005052	splice site	probably benign
R3617:Cntln	UTSW	4	85004977	nonsense	probably null
R4009:Cntln	UTSW	4	85063215	missense	probably benign	0.45
R4036:Cntln	UTSW	4	85006488	missense	probably damaging	1.00
R4548:Cntln	UTSW	4	85096842	missense	probably benign	0.27
R4592:Cntln	UTSW	4	84971182	missense	probably benign	0.00
R4666:Cntln	UTSW	4	84971216	missense	probably benign	0.13
R4826:Cntln	UTSW	4	85005044	missense	probably benign	0.03
R4836:Cntln	UTSW	4	85049720	nonsense	probably null
R4856:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4886:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4995:Cntln	UTSW	4	85049883	missense	probably benign	0.00
R5090:Cntln	UTSW	4	84947593	missense	probably damaging	0.98
R5202:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R5905:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R5953:Cntln	UTSW	4	85049919	missense	possibly damaging	0.92
R6028:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6298:Cntln	UTSW	4	85096761	missense	probably damaging	1.00
R6351:Cntln	UTSW	4	85115354	missense	probably damaging	0.99
R6371:Cntln	UTSW	4	84884579	missense	probably damaging	0.98
R6481:Cntln	UTSW	4	85067510	missense	probably benign	0.00
R6864:Cntln	UTSW	4	85096792	missense	probably damaging	0.99
R6874:Cntln	UTSW	4	85067759	missense	probably damaging	1.00
R6919:Cntln	UTSW	4	85115368	missense	probably benign	0.04
R7071:Cntln	UTSW	4	85100385	missense	probably damaging	1.00
R7113:Cntln	UTSW	4	85049827	missense	probably damaging	0.98
R7152:Cntln	UTSW	4	84884700	missense	possibly damaging	0.87
R7253:Cntln	UTSW	4	85118473	missense	probably damaging	1.00
R7289:Cntln	UTSW	4	85046303	missense	possibly damaging	0.80
R7440:Cntln	UTSW	4	85063216	missense	possibly damaging	0.95
R7670:Cntln	UTSW	4	84979340	missense	possibly damaging	0.66
R7707:Cntln	UTSW	4	84884616	missense	probably damaging	1.00
R7895:Cntln	UTSW	4	85063324	missense	possibly damaging	0.91
R8176:Cntln	UTSW	4	84888689	missense	probably damaging	0.99
R8247:Cntln	UTSW	4	85100780	missense	probably benign	0.39
R8264:Cntln	UTSW	4	85098411	missense	probably damaging	1.00
R8293:Cntln	UTSW	4	85033838	missense	probably damaging	1.00
R8536:Cntln	UTSW	4	84957049	missense	probably damaging	1.00
R8844:Cntln	UTSW	4	84973997	missense	probably damaging	1.00
R8924:Cntln	UTSW	4	84888699	missense	probably damaging	1.00
R8955:Cntln	UTSW	4	85067873	missense	possibly damaging	0.85
R8960:Cntln	UTSW	4	85100724	missense	possibly damaging	0.59
R8979:Cntln	UTSW	4	85130673	missense	probably damaging	1.00
R9255:Cntln	UTSW	4	85100866	missense	possibly damaging	0.93
R9314:Cntln	UTSW	4	85006482	missense	probably damaging	1.00
R9353:Cntln	UTSW	4	84884360	unclassified	probably benign
R9361:Cntln	UTSW	4	85049914	missense	probably benign	0.23
R9376:Cntln	UTSW	4	84957021	missense	probably benign	0.24
R9471:Cntln	UTSW	4	85049782	missense	possibly damaging	0.62
R9478:Cntln	UTSW	4	84979393	missense	probably benign	0.00
R9527:Cntln	UTSW	4	84973883	missense	probably damaging	1.00
R9788:Cntln	UTSW	4	85049856	missense	probably damaging	1.00
R9793:Cntln	UTSW	4	85067561	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCCTGAGGAGACAAGTGAC -3'
(R):5'- GACCTCCCAAGATATTTCAAAGGC -3'

Sequencing Primer
(F):5'- ATGAAGAGGTGGTGTGCCC -3'
(R):5'- CCAAGATATTTCAAAGGCTCTGACAG -3'

Posted On

2022-04-18