Incidental Mutation 'R9382:1600015I10Rik'
ID 710099
Institutional Source Beutler Lab
Gene Symbol 1600015I10Rik
Ensembl Gene ENSMUSG00000029813
Gene Name RIKEN cDNA 1600015I10 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock # R9382 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 48929895-48933687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 48930364 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 99 (K99N)
Ref Sequence ENSEMBL: ENSMUSP00000031837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031837]
AlphaFold E9Q745
Predicted Effect probably benign
Transcript: ENSMUST00000031837
AA Change: K99N

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031837
Gene: ENSMUSG00000029813
AA Change: K99N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 50 136 1.7e-25 PFAM
Pfam:Cu_amine_oxidN3 152 252 3.5e-16 PFAM
Pfam:Cu_amine_oxid 306 708 7.1e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,979,885 S147L probably benign Het
Abraxas1 A G 5: 100,809,783 V190A probably benign Het
Aox1 T A 1: 58,065,342 H559Q possibly damaging Het
Arhgap31 C T 16: 38,602,626 G1026D probably benign Het
C1ra T C 6: 124,513,860 F71L probably benign Het
C530025M09Rik T C 2: 149,830,720 H165R unknown Het
Celf2 A T 2: 6,721,593 M43K probably damaging Het
Celsr3 T C 9: 108,829,762 V1148A possibly damaging Het
Cmya5 T G 13: 93,093,376 K1735Q probably benign Het
Cntln A C 4: 85,050,081 M846L probably benign Het
Cntn5 T C 9: 9,673,812 T762A probably benign Het
Col11a1 T A 3: 114,105,397 L525Q unknown Het
Col12a1 T C 9: 79,682,082 T1064A probably benign Het
Cyc1 T C 15: 76,345,073 V211A possibly damaging Het
Ddx56 A G 11: 6,265,516 S296P probably damaging Het
Deptor A T 15: 55,112,402 probably benign Het
Ezh1 C T 11: 101,203,439 R409H possibly damaging Het
Fam228b T A 12: 4,748,147 E190V probably damaging Het
Fkbp15 A T 4: 62,318,973 L635H probably damaging Het
Frem1 G A 4: 82,983,385 L969F possibly damaging Het
Gabrg2 T C 11: 41,967,606 R232G probably benign Het
Gpr26 G A 7: 131,967,234 D103N probably damaging Het
Grid2ip T G 5: 143,375,348 probably null Het
Ints7 T C 1: 191,619,681 V834A probably damaging Het
Kcnh7 T A 2: 62,837,268 H309L probably benign Het
Mael T C 1: 166,225,713 E241G probably damaging Het
Neb T A 2: 52,232,265 E584V Het
Nexn C T 3: 152,253,764 V23M probably damaging Het
Npas1 T C 7: 16,456,306 probably null Het
Olfr566 T C 7: 102,856,807 I158M probably benign Het
Pcdh17 T G 14: 84,448,082 V663G probably damaging Het
Pga5 C T 19: 10,669,533 G303S probably damaging Het
Poln T A 5: 34,007,498 K844N probably damaging Het
Prkar1b C T 5: 139,050,687 D227N probably damaging Het
Proc T A 18: 32,123,283 I444F probably damaging Het
Ptprn G T 1: 75,252,491 H791N probably benign Het
Ror1 T C 4: 100,334,512 S160P probably benign Het
Satb2 T A 1: 56,831,638 probably null Het
Slc43a3 C T 2: 84,950,427 A332V probably benign Het
Sp100 G A 1: 85,699,615 V410M probably damaging Het
Srgap2 T C 1: 131,289,608 T989A probably benign Het
Ssc5d T C 7: 4,927,284 probably null Het
Tll2 A G 19: 41,128,558 Y273H probably benign Het
Tub T C 7: 109,027,004 V295A possibly damaging Het
Unc13b T A 4: 43,172,512 D1113E unknown Het
Usp9y C A Y: 1,364,776 M1012I probably benign Het
Vmn1r238 A G 18: 3,122,676 V246A probably damaging Het
Vmn2r88 T G 14: 51,418,740 V802G Het
Wnt7b T C 15: 85,558,974 Q76R probably damaging Het
Zan T C 5: 137,391,655 R4852G unknown Het
Zfp618 A T 4: 63,133,021 T680S probably damaging Het
Zfp784 T A 7: 5,038,339 D25V unknown Het
Other mutations in 1600015I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:1600015I10Rik APN 6 48931040 missense probably damaging 1.00
IGL01347:1600015I10Rik APN 6 48932543 missense probably benign 0.02
IGL01751:1600015I10Rik APN 6 48930588 missense possibly damaging 0.79
IGL01915:1600015I10Rik APN 6 48931648 missense probably damaging 1.00
IGL02669:1600015I10Rik APN 6 48931473 missense probably damaging 1.00
IGL03033:1600015I10Rik APN 6 48932518 missense probably benign 0.00
IGL03242:1600015I10Rik APN 6 48932545 missense possibly damaging 0.68
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0448:1600015I10Rik UTSW 6 48933057 missense probably damaging 1.00
R1488:1600015I10Rik UTSW 6 48933447 missense possibly damaging 0.91
R1498:1600015I10Rik UTSW 6 48931371 missense probably benign 0.00
R1520:1600015I10Rik UTSW 6 48931297 nonsense probably null
R1922:1600015I10Rik UTSW 6 48931286 missense probably benign 0.00
R1992:1600015I10Rik UTSW 6 48930769 missense probably damaging 1.00
R1997:1600015I10Rik UTSW 6 48932429 missense probably damaging 0.98
R2021:1600015I10Rik UTSW 6 48931451 missense probably damaging 1.00
R3771:1600015I10Rik UTSW 6 48931196 missense probably damaging 1.00
R4208:1600015I10Rik UTSW 6 48931647 missense probably damaging 1.00
R4790:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5114:1600015I10Rik UTSW 6 48931358 missense probably benign 0.02
R5610:1600015I10Rik UTSW 6 48931019 missense probably benign 0.00
R5823:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5847:1600015I10Rik UTSW 6 48933478 missense probably damaging 1.00
R6233:1600015I10Rik UTSW 6 48930965 missense probably benign
R6357:1600015I10Rik UTSW 6 48930974 missense probably benign 0.00
R6694:1600015I10Rik UTSW 6 48930546 missense probably benign 0.21
R6733:1600015I10Rik UTSW 6 48930530 missense probably damaging 1.00
R6894:1600015I10Rik UTSW 6 48930662 missense probably damaging 1.00
R6898:1600015I10Rik UTSW 6 48931041 missense probably damaging 0.97
R6916:1600015I10Rik UTSW 6 48931053 missense probably benign 0.01
R7242:1600015I10Rik UTSW 6 48931128 missense probably damaging 1.00
R7762:1600015I10Rik UTSW 6 48932686 missense probably benign 0.07
R8257:1600015I10Rik UTSW 6 48932497 missense probably benign 0.04
R8391:1600015I10Rik UTSW 6 48932668 missense probably damaging 0.96
R8839:1600015I10Rik UTSW 6 48931040 missense probably damaging 1.00
R8863:1600015I10Rik UTSW 6 48930108 missense probably benign 0.00
R9266:1600015I10Rik UTSW 6 48930237 missense probably benign 0.00
R9274:1600015I10Rik UTSW 6 48930407 missense possibly damaging 0.94
R9380:1600015I10Rik UTSW 6 48933130 missense probably damaging 1.00
R9562:1600015I10Rik UTSW 6 48930975 missense probably benign 0.01
R9565:1600015I10Rik UTSW 6 48930975 missense probably benign 0.01
X0062:1600015I10Rik UTSW 6 48933132 missense possibly damaging 0.55
Z1176:1600015I10Rik UTSW 6 48932468 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GGTATTCGCAGACCTGAGTG -3'
(R):5'- ACTGATGCAGAGACTTGGTG -3'

Sequencing Primer
(F):5'- CGCAGACCTGAGTGTTTATGAGATC -3'
(R):5'- CCTCTGTCAGCGTACGGTAGATG -3'
Posted On 2022-04-18