Incidental Mutation 'R9382:Tub'
ID 710105
Institutional Source Beutler Lab
Gene Symbol Tub
Ensembl Gene ENSMUSG00000031028
Gene Name tubby bipartite transcription factor
Synonyms rd5, tub
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9382 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 108950338-109034460 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 109027004 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 295 (V295A)
Ref Sequence ENSEMBL: ENSMUSP00000033341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033341] [ENSMUST00000119474] [ENSMUST00000207583]
AlphaFold P50586
PDB Structure C-TERMINAL DOMAIN OF MOUSE BRAIN TUBBY PROTEIN [X-RAY DIFFRACTION]
C-Terminal Domain Of Mouse Brain Tubby Protein bound to Phosphatidylinositol 4,5-bis-phosphate [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033341
AA Change: V295A

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033341
Gene: ENSMUSG00000031028
AA Change: V295A

DomainStartEndE-ValueType
Pfam:Tub_N 29 237 2.5e-58 PFAM
Pfam:Tub 257 499 2.4e-88 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119474
AA Change: V249A

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113580
Gene: ENSMUSG00000031028
AA Change: V249A

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
low complexity region 145 174 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
Pfam:Tub 211 453 2.4e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207583
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Tubby family of bipartite transcription factors. The encoded protein may play a role in obesity and sensorineural degradation. The crystal structure has been determined for a similar protein in mouse, and it functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit a late-developing obesity with hyperinsulinemia, retinal degeneration, and hearing loss associated with death of both outer and inner hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,930,364 K99N probably benign Het
Abca8b G A 11: 109,979,885 S147L probably benign Het
Abraxas1 A G 5: 100,809,783 V190A probably benign Het
Aox1 T A 1: 58,065,342 H559Q possibly damaging Het
Arhgap31 C T 16: 38,602,626 G1026D probably benign Het
C1ra T C 6: 124,513,860 F71L probably benign Het
C530025M09Rik T C 2: 149,830,720 H165R unknown Het
Celf2 A T 2: 6,721,593 M43K probably damaging Het
Celsr3 T C 9: 108,829,762 V1148A possibly damaging Het
Cmya5 T G 13: 93,093,376 K1735Q probably benign Het
Cntln A C 4: 85,050,081 M846L probably benign Het
Cntn5 T C 9: 9,673,812 T762A probably benign Het
Col11a1 T A 3: 114,105,397 L525Q unknown Het
Col12a1 T C 9: 79,682,082 T1064A probably benign Het
Cyc1 T C 15: 76,345,073 V211A possibly damaging Het
Ddx56 A G 11: 6,265,516 S296P probably damaging Het
Deptor A T 15: 55,112,402 probably benign Het
Ezh1 C T 11: 101,203,439 R409H possibly damaging Het
Fam228b T A 12: 4,748,147 E190V probably damaging Het
Fkbp15 A T 4: 62,318,973 L635H probably damaging Het
Frem1 G A 4: 82,983,385 L969F possibly damaging Het
Gabrg2 T C 11: 41,967,606 R232G probably benign Het
Gpr26 G A 7: 131,967,234 D103N probably damaging Het
Grid2ip T G 5: 143,375,348 probably null Het
Ints7 T C 1: 191,619,681 V834A probably damaging Het
Kcnh7 T A 2: 62,837,268 H309L probably benign Het
Mael T C 1: 166,225,713 E241G probably damaging Het
Neb T A 2: 52,232,265 E584V Het
Nexn C T 3: 152,253,764 V23M probably damaging Het
Npas1 T C 7: 16,456,306 probably null Het
Olfr566 T C 7: 102,856,807 I158M probably benign Het
Pcdh17 T G 14: 84,448,082 V663G probably damaging Het
Pga5 C T 19: 10,669,533 G303S probably damaging Het
Poln T A 5: 34,007,498 K844N probably damaging Het
Prkar1b C T 5: 139,050,687 D227N probably damaging Het
Proc T A 18: 32,123,283 I444F probably damaging Het
Ptprn G T 1: 75,252,491 H791N probably benign Het
Ror1 T C 4: 100,334,512 S160P probably benign Het
Satb2 T A 1: 56,831,638 probably null Het
Slc43a3 C T 2: 84,950,427 A332V probably benign Het
Sp100 G A 1: 85,699,615 V410M probably damaging Het
Srgap2 T C 1: 131,289,608 T989A probably benign Het
Ssc5d T C 7: 4,927,284 probably null Het
Tll2 A G 19: 41,128,558 Y273H probably benign Het
Unc13b T A 4: 43,172,512 D1113E unknown Het
Usp9y C A Y: 1,364,776 M1012I probably benign Het
Vmn1r238 A G 18: 3,122,676 V246A probably damaging Het
Vmn2r88 T G 14: 51,418,740 V802G Het
Wnt7b T C 15: 85,558,974 Q76R probably damaging Het
Zan T C 5: 137,391,655 R4852G unknown Het
Zfp618 A T 4: 63,133,021 T680S probably damaging Het
Zfp784 T A 7: 5,038,339 D25V unknown Het
Other mutations in Tub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Tub APN 7 109021036 splice site probably benign
IGL02715:Tub APN 7 109029310 missense probably benign
grasso UTSW 7 109029650 missense probably damaging 1.00
troy UTSW 7 109020954 nonsense probably null
R0152:Tub UTSW 7 109020927 missense probably damaging 1.00
R0233:Tub UTSW 7 109029341 missense possibly damaging 0.63
R0233:Tub UTSW 7 109029341 missense possibly damaging 0.63
R0317:Tub UTSW 7 109020927 missense probably damaging 1.00
R1382:Tub UTSW 7 109030153 missense probably damaging 1.00
R1395:Tub UTSW 7 109020954 nonsense probably null
R1588:Tub UTSW 7 109029681 missense probably damaging 1.00
R1975:Tub UTSW 7 109027835 missense possibly damaging 0.74
R2047:Tub UTSW 7 109026732 missense probably benign 0.30
R2121:Tub UTSW 7 109026737 missense probably damaging 1.00
R2414:Tub UTSW 7 109027033 missense probably damaging 1.00
R3694:Tub UTSW 7 109027832 missense probably benign
R3695:Tub UTSW 7 109027832 missense probably benign
R4914:Tub UTSW 7 109020954 nonsense probably null
R5139:Tub UTSW 7 109011102 start codon destroyed probably null 0.53
R5347:Tub UTSW 7 109026771 missense possibly damaging 0.67
R5557:Tub UTSW 7 109025718 missense probably damaging 0.99
R6000:Tub UTSW 7 109029650 missense probably damaging 1.00
R6245:Tub UTSW 7 109027058 missense probably damaging 1.00
R6888:Tub UTSW 7 109029298 missense probably null 1.00
R7316:Tub UTSW 7 109030171 missense possibly damaging 0.69
R8120:Tub UTSW 7 109025596 splice site probably null
R8223:Tub UTSW 7 109029326 missense probably benign 0.33
R8885:Tub UTSW 7 109029586 missense
R8978:Tub UTSW 7 109030186 missense probably damaging 1.00
R9158:Tub UTSW 7 109026755 missense possibly damaging 0.66
R9414:Tub UTSW 7 109027058 missense probably damaging 1.00
RF005:Tub UTSW 7 109022639 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGTTTGAAGGCCGGAAG -3'
(R):5'- CTGGTCCTGTCTGACTCAAG -3'

Sequencing Primer
(F):5'- GGCTAGAATAGGAGGGGAGCTC -3'
(R):5'- TCAAGGCTGGGAAGACTCCTTC -3'
Posted On 2022-04-18