Incidental Mutation 'R9382:Vmn1r238'
ID 710122
Institutional Source Beutler Lab
Gene Symbol Vmn1r238
Ensembl Gene ENSMUSG00000091539
Gene Name vomeronasal 1 receptor, 238
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9382 (G1)
Quality Score 205.009
Status Not validated
Chromosome 18
Chromosomal Location 3122492-3123412 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3122676 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 246 (V246A)
Ref Sequence ENSEMBL: ENSMUSP00000129804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165255]
AlphaFold E9Q373
Predicted Effect probably damaging
Transcript: ENSMUST00000165255
AA Change: V246A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129804
Gene: ENSMUSG00000091539
AA Change: V246A

DomainStartEndE-ValueType
Pfam:TAS2R 7 302 5.3e-8 PFAM
Pfam:7tm_1 27 292 8.8e-7 PFAM
Pfam:V1R 34 298 1.9e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,930,364 K99N probably benign Het
Abca8b G A 11: 109,979,885 S147L probably benign Het
Abraxas1 A G 5: 100,809,783 V190A probably benign Het
Aox1 T A 1: 58,065,342 H559Q possibly damaging Het
Arhgap31 C T 16: 38,602,626 G1026D probably benign Het
C1ra T C 6: 124,513,860 F71L probably benign Het
C530025M09Rik T C 2: 149,830,720 H165R unknown Het
Celf2 A T 2: 6,721,593 M43K probably damaging Het
Celsr3 T C 9: 108,829,762 V1148A possibly damaging Het
Cmya5 T G 13: 93,093,376 K1735Q probably benign Het
Cntln A C 4: 85,050,081 M846L probably benign Het
Cntn5 T C 9: 9,673,812 T762A probably benign Het
Col11a1 T A 3: 114,105,397 L525Q unknown Het
Col12a1 T C 9: 79,682,082 T1064A probably benign Het
Cyc1 T C 15: 76,345,073 V211A possibly damaging Het
Ddx56 A G 11: 6,265,516 S296P probably damaging Het
Deptor A T 15: 55,112,402 probably benign Het
Ezh1 C T 11: 101,203,439 R409H possibly damaging Het
Fam228b T A 12: 4,748,147 E190V probably damaging Het
Fkbp15 A T 4: 62,318,973 L635H probably damaging Het
Frem1 G A 4: 82,983,385 L969F possibly damaging Het
Gabrg2 T C 11: 41,967,606 R232G probably benign Het
Gpr26 G A 7: 131,967,234 D103N probably damaging Het
Grid2ip T G 5: 143,375,348 probably null Het
Ints7 T C 1: 191,619,681 V834A probably damaging Het
Kcnh7 T A 2: 62,837,268 H309L probably benign Het
Mael T C 1: 166,225,713 E241G probably damaging Het
Neb T A 2: 52,232,265 E584V Het
Nexn C T 3: 152,253,764 V23M probably damaging Het
Npas1 T C 7: 16,456,306 probably null Het
Olfr566 T C 7: 102,856,807 I158M probably benign Het
Pcdh17 T G 14: 84,448,082 V663G probably damaging Het
Pga5 C T 19: 10,669,533 G303S probably damaging Het
Poln T A 5: 34,007,498 K844N probably damaging Het
Prkar1b C T 5: 139,050,687 D227N probably damaging Het
Proc T A 18: 32,123,283 I444F probably damaging Het
Ptprn G T 1: 75,252,491 H791N probably benign Het
Ror1 T C 4: 100,334,512 S160P probably benign Het
Satb2 T A 1: 56,831,638 probably null Het
Slc43a3 C T 2: 84,950,427 A332V probably benign Het
Sp100 G A 1: 85,699,615 V410M probably damaging Het
Srgap2 T C 1: 131,289,608 T989A probably benign Het
Ssc5d T C 7: 4,927,284 probably null Het
Tll2 A G 19: 41,128,558 Y273H probably benign Het
Tub T C 7: 109,027,004 V295A possibly damaging Het
Unc13b T A 4: 43,172,512 D1113E unknown Het
Usp9y C A Y: 1,364,776 M1012I probably benign Het
Vmn2r88 T G 14: 51,418,740 V802G Het
Wnt7b T C 15: 85,558,974 Q76R probably damaging Het
Zan T C 5: 137,391,655 R4852G unknown Het
Zfp618 A T 4: 63,133,021 T680S probably damaging Het
Zfp784 T A 7: 5,038,339 D25V unknown Het
Other mutations in Vmn1r238
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn1r238 APN 18 3123243 missense probably benign 0.01
IGL01385:Vmn1r238 APN 18 3122770 missense possibly damaging 0.83
IGL02716:Vmn1r238 APN 18 3123124 missense probably damaging 1.00
R1219:Vmn1r238 UTSW 18 3123135 missense possibly damaging 0.81
R1568:Vmn1r238 UTSW 18 3123358 missense probably benign 0.00
R1864:Vmn1r238 UTSW 18 3123040 nonsense probably null
R3024:Vmn1r238 UTSW 18 3123305 missense probably benign 0.13
R4291:Vmn1r238 UTSW 18 3123214 nonsense probably null
R4304:Vmn1r238 UTSW 18 3123040 nonsense probably null
R4586:Vmn1r238 UTSW 18 3123294 missense probably damaging 1.00
R4664:Vmn1r238 UTSW 18 3123300 missense probably damaging 0.99
R5123:Vmn1r238 UTSW 18 3123243 missense probably benign
R5430:Vmn1r238 UTSW 18 3122521 missense possibly damaging 0.63
R5834:Vmn1r238 UTSW 18 3123168 missense probably benign
R7186:Vmn1r238 UTSW 18 3122661 missense probably damaging 0.99
R7206:Vmn1r238 UTSW 18 3122623 missense possibly damaging 0.94
R7308:Vmn1r238 UTSW 18 3122875 missense probably benign 0.09
R7346:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R7467:Vmn1r238 UTSW 18 3123393 missense probably benign 0.10
R7571:Vmn1r238 UTSW 18 3122721 missense probably damaging 1.00
R7808:Vmn1r238 UTSW 18 3123033 missense probably benign 0.03
R8085:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R8086:Vmn1r238 UTSW 18 3123250 missense probably damaging 1.00
R8325:Vmn1r238 UTSW 18 3122529 missense probably benign 0.00
R8423:Vmn1r238 UTSW 18 3123365 nonsense probably null
R8747:Vmn1r238 UTSW 18 3123232 missense possibly damaging 0.87
R8930:Vmn1r238 UTSW 18 3123127 missense probably benign 0.03
R8932:Vmn1r238 UTSW 18 3123127 missense probably benign 0.03
R9279:Vmn1r238 UTSW 18 3122994 missense probably damaging 0.99
Z1177:Vmn1r238 UTSW 18 3122505 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAAGTTATCTCTTACCTAAGCAGGG -3'
(R):5'- TGCTTCTGACAGTGTAGCAAC -3'

Sequencing Primer
(F):5'- CCTAAGCAGGGTAAAAACAGATTG -3'
(R):5'- ATCTTTAGTGTGCTTCTCTGATGTC -3'
Posted On 2022-04-18