Incidental Mutation 'R9383:Gpnmb'
ID 710147
Institutional Source Beutler Lab
Gene Symbol Gpnmb
Ensembl Gene ENSMUSG00000029816
Gene Name glycoprotein (transmembrane) nmb
Synonyms Osteoactivin, DC-HIL, Dchil
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9383 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 49013449-49044413 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49028918 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 479 (S479G)
Ref Sequence ENSEMBL: ENSMUSP00000031840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031840] [ENSMUST00000204260]
AlphaFold Q99P91
Predicted Effect probably damaging
Transcript: ENSMUST00000031840
AA Change: S479G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031840
Gene: ENSMUSG00000029816
AA Change: S479G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
PKD 250 386 4.96e-9 SMART
transmembrane domain 500 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204260
AA Change: S479G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145376
Gene: ENSMUSG00000029816
AA Change: S479G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
PKD 250 386 4.96e-9 SMART
transmembrane domain 503 525 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane glycoprotein which shows homology to the pMEL17 precursor, a melanocyte-specific protein. GPNMB shows expression in the lowly metastatic human melanoma cell lines and xenografts but does not show expression in the highly metastatic cell lines. GPNMB may be involved in growth delay and reduction of metastatic potential. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit dispersed pigmentation of the iris, deterioration of the posterior iris epithelium and slit-like transillumination defects. The mutation contributes to glaucoma, especially in combination with the brown coat color mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 A G 8: 95,661,162 (GRCm39) E124G Het
Atp1a2 T C 1: 172,107,334 (GRCm39) I729V probably benign Het
Ccn2 T G 10: 24,471,883 (GRCm39) V58G possibly damaging Het
Chd2 T A 7: 73,098,918 (GRCm39) E1467V probably null Het
Col6a5 T C 9: 105,803,110 (GRCm39) D1285G unknown Het
Coro7 A G 16: 4,452,888 (GRCm39) C287R probably damaging Het
Cpa3 T C 3: 20,283,045 (GRCm39) E134G probably benign Het
Csf3r C T 4: 125,937,239 (GRCm39) P708S possibly damaging Het
Defb30 T C 14: 63,273,463 (GRCm39) E49G probably benign Het
Dnah3 A T 7: 119,646,819 (GRCm39) I1070K probably benign Het
Dnm2 G A 9: 21,383,920 (GRCm39) V234M probably damaging Het
Drg2 T A 11: 60,350,287 (GRCm39) M82K probably benign Het
Dus2 G A 8: 106,776,950 (GRCm39) E312K probably benign Het
Efcab6 T C 15: 83,756,620 (GRCm39) E1240G possibly damaging Het
Ep400 T C 5: 110,833,351 (GRCm39) E1957G unknown Het
Gpr153 T C 4: 152,367,516 (GRCm39) S456P probably benign Het
Gprc5b A T 7: 118,575,761 (GRCm39) M388K probably damaging Het
H2-T23 T C 17: 36,343,227 (GRCm39) D50G possibly damaging Het
Hipk1 T C 3: 103,684,883 (GRCm39) E244G probably damaging Het
Malrd1 T A 2: 15,700,012 (GRCm39) C620S unknown Het
Maz G A 7: 126,624,083 (GRCm39) Q358* probably null Het
Mcc A T 18: 44,575,985 (GRCm39) I901N probably benign Het
Megf11 T G 9: 64,545,732 (GRCm39) C172G probably damaging Het
Mipol1 A G 12: 57,352,820 (GRCm39) Y53C probably benign Het
Nectin4 C T 1: 171,213,251 (GRCm39) T391I probably damaging Het
Nell2 A T 15: 95,282,957 (GRCm39) Y362N possibly damaging Het
Nphp4 T C 4: 152,628,918 (GRCm39) probably null Het
Nsun4 A G 4: 115,891,473 (GRCm39) V302A probably benign Het
Odf2 T A 2: 29,791,249 (GRCm39) L181H probably damaging Het
Opn1sw A G 6: 29,378,000 (GRCm39) S328P possibly damaging Het
Or8k30 T C 2: 86,338,854 (GRCm39) I17T probably damaging Het
Pga5 C T 19: 10,646,897 (GRCm39) G303S probably damaging Het
Pik3c2g T A 6: 139,827,742 (GRCm39) Y712* probably null Het
Pkd1 C T 17: 24,794,900 (GRCm39) R2196C probably damaging Het
Pkd1l3 TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA 8: 110,350,601 (GRCm39) probably benign Het
Plekhm2 A T 4: 141,359,612 (GRCm39) M385K probably damaging Het
Pole T C 5: 110,438,892 (GRCm39) V164A possibly damaging Het
Prr19 T A 7: 25,002,335 (GRCm39) F11Y probably damaging Het
Prtg G T 9: 72,757,143 (GRCm39) L355F probably benign Het
Raph1 C A 1: 60,564,829 (GRCm39) M219I unknown Het
Rtkn2 A G 10: 67,839,094 (GRCm39) D140G possibly damaging Het
Serpina5 T C 12: 104,070,131 (GRCm39) S343P probably damaging Het
Slc1a1 A G 19: 28,889,125 (GRCm39) K466R probably benign Het
Slc43a1 G A 2: 84,690,506 (GRCm39) V518M probably damaging Het
Slc47a2 A G 11: 61,227,749 (GRCm39) L125P probably damaging Het
Slc4a7 C A 14: 14,766,803 (GRCm38) C585* probably null Het
Snx19 A G 9: 30,347,196 (GRCm39) E713G probably damaging Het
Tiam1 C T 16: 89,655,561 (GRCm39) V715M probably damaging Het
Tln2 T A 9: 67,278,043 (GRCm39) M322L probably benign Het
Top2a G A 11: 98,901,884 (GRCm39) R449* probably null Het
Trpv4 C A 5: 114,796,474 (GRCm39) probably benign Het
Vmn1r214 A C 13: 23,219,095 (GRCm39) R196S probably benign Het
Vmn1r43 A T 6: 89,846,552 (GRCm39) H311Q possibly damaging Het
Vmn1r54 A G 6: 90,247,009 (GRCm39) T308A probably benign Het
Zfand3 T A 17: 30,354,479 (GRCm39) Y99N probably benign Het
Zfp119b T C 17: 56,246,355 (GRCm39) Y277C probably damaging Het
Zfp345 G A 2: 150,314,503 (GRCm39) H345Y possibly damaging Het
Zyg11a T C 4: 108,046,926 (GRCm39) E516G probably damaging Het
Other mutations in Gpnmb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Gpnmb APN 6 49,032,593 (GRCm39) missense probably benign 0.01
IGL01291:Gpnmb APN 6 49,032,615 (GRCm39) missense probably benign 0.12
IGL01307:Gpnmb APN 6 49,022,299 (GRCm39) missense probably benign 0.03
IGL01398:Gpnmb APN 6 49,027,365 (GRCm39) missense probably benign 0.02
IGL01531:Gpnmb APN 6 49,024,392 (GRCm39) splice site probably benign
IGL01936:Gpnmb APN 6 49,024,384 (GRCm39) missense probably null 1.00
ANU05:Gpnmb UTSW 6 49,032,615 (GRCm39) missense probably benign 0.12
R0242:Gpnmb UTSW 6 49,024,276 (GRCm39) missense probably damaging 0.99
R0242:Gpnmb UTSW 6 49,024,276 (GRCm39) missense probably damaging 0.99
R0413:Gpnmb UTSW 6 49,019,737 (GRCm39) missense probably benign
R0690:Gpnmb UTSW 6 49,024,949 (GRCm39) missense probably benign 0.24
R0884:Gpnmb UTSW 6 49,024,847 (GRCm39) missense possibly damaging 0.65
R1659:Gpnmb UTSW 6 49,024,786 (GRCm39) missense probably damaging 1.00
R3703:Gpnmb UTSW 6 49,028,799 (GRCm39) missense possibly damaging 0.95
R3705:Gpnmb UTSW 6 49,028,799 (GRCm39) missense possibly damaging 0.95
R4629:Gpnmb UTSW 6 49,027,994 (GRCm39) missense possibly damaging 0.82
R4782:Gpnmb UTSW 6 49,022,417 (GRCm39) splice site probably null
R4799:Gpnmb UTSW 6 49,022,417 (GRCm39) splice site probably null
R4916:Gpnmb UTSW 6 49,028,904 (GRCm39) missense probably damaging 1.00
R5223:Gpnmb UTSW 6 49,033,139 (GRCm39) missense probably benign 0.01
R5390:Gpnmb UTSW 6 49,024,775 (GRCm39) missense probably damaging 1.00
R5512:Gpnmb UTSW 6 49,022,398 (GRCm39) missense possibly damaging 0.62
R5833:Gpnmb UTSW 6 49,020,952 (GRCm39) missense probably damaging 1.00
R6103:Gpnmb UTSW 6 49,019,820 (GRCm39) missense possibly damaging 0.86
R7211:Gpnmb UTSW 6 49,028,949 (GRCm39) missense possibly damaging 0.82
R7900:Gpnmb UTSW 6 49,027,400 (GRCm39) missense possibly damaging 0.83
R8859:Gpnmb UTSW 6 49,028,964 (GRCm39) splice site probably benign
R9393:Gpnmb UTSW 6 49,024,996 (GRCm39) missense possibly damaging 0.89
Z1176:Gpnmb UTSW 6 49,028,766 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACCCCTGTCTCATGTCACAG -3'
(R):5'- TTGTGAGTTACTGCATACCTAAGC -3'

Sequencing Primer
(F):5'- GTCTCATGTCACAGCACCC -3'
(R):5'- TTACTGCATACCTAAGCCACATAGTG -3'
Posted On 2022-04-18