Incidental Mutation 'R9383:Pik3c2g'
ID 710150
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock # R9383 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 139587221-139969284 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 139882016 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 712 (Y712*)
Ref Sequence ENSEMBL: ENSMUSP00000107499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000087657
AA Change: Y344*
SMART Domains Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: Y344*

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111868
AA Change: Y712*
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: Y712*

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000218528
AA Change: Y594*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 A G 8: 94,934,534 E124G Het
Atp1a2 T C 1: 172,279,767 I729V probably benign Het
Chd2 T A 7: 73,449,170 E1467V probably null Het
Col6a5 T C 9: 105,925,911 D1285G unknown Het
Coro7 A G 16: 4,635,024 C287R probably damaging Het
Cpa3 T C 3: 20,228,881 E134G probably benign Het
Csf3r C T 4: 126,043,446 P708S possibly damaging Het
Ctgf T G 10: 24,595,985 V58G possibly damaging Het
Defb30 T C 14: 63,036,014 E49G probably benign Het
Dnah3 A T 7: 120,047,596 I1070K probably benign Het
Dnm2 G A 9: 21,472,624 V234M probably damaging Het
Drg2 T A 11: 60,459,461 M82K probably benign Het
Dus2 G A 8: 106,050,318 E312K probably benign Het
Efcab6 T C 15: 83,872,419 E1240G possibly damaging Het
Ep400 T C 5: 110,685,485 E1957G unknown Het
Gpnmb A G 6: 49,051,984 S479G probably damaging Het
Gpr153 T C 4: 152,283,059 S456P probably benign Het
Gprc5b A T 7: 118,976,538 M388K probably damaging Het
H2-T23 T C 17: 36,032,335 D50G possibly damaging Het
Hipk1 T C 3: 103,777,567 E244G probably damaging Het
Malrd1 T A 2: 15,695,201 C620S unknown Het
Maz G A 7: 127,024,911 Q358* probably null Het
Mcc A T 18: 44,442,918 I901N probably benign Het
Megf11 T G 9: 64,638,450 C172G probably damaging Het
Mipol1 A G 12: 57,306,034 Y53C probably benign Het
Nectin4 C T 1: 171,385,683 T391I probably damaging Het
Nell2 A T 15: 95,385,076 Y362N possibly damaging Het
Nphp4 T C 4: 152,544,461 probably null Het
Nsun4 A G 4: 116,034,276 V302A probably benign Het
Odf2 T A 2: 29,901,237 L181H probably damaging Het
Olfr1076 T C 2: 86,508,510 I17T probably damaging Het
Opn1sw A G 6: 29,378,001 S328P possibly damaging Het
Pga5 C T 19: 10,669,533 G303S probably damaging Het
Pkd1 C T 17: 24,575,926 R2196C probably damaging Het
Pkd1l3 TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA 8: 109,623,969 probably benign Het
Plekhm2 A T 4: 141,632,301 M385K probably damaging Het
Pole T C 5: 110,291,026 V164A possibly damaging Het
Prr19 T A 7: 25,302,910 F11Y probably damaging Het
Prtg G T 9: 72,849,861 L355F probably benign Het
Raph1 C A 1: 60,525,670 M219I unknown Het
Rtkn2 A G 10: 68,003,264 D140G possibly damaging Het
Serpina5 T C 12: 104,103,872 S343P probably damaging Het
Slc1a1 A G 19: 28,911,725 K466R probably benign Het
Slc43a1 G A 2: 84,860,162 V518M probably damaging Het
Slc47a2 A G 11: 61,336,923 L125P probably damaging Het
Slc4a7 C A 14: 14,766,803 C585* probably null Het
Snx19 A G 9: 30,435,900 E713G probably damaging Het
Tiam1 C T 16: 89,858,673 V715M probably damaging Het
Tln2 T A 9: 67,370,761 M322L probably benign Het
Top2a G A 11: 99,011,058 R449* probably null Het
Trpv4 C A 5: 114,658,413 probably benign Het
Vmn1r214 A C 13: 23,034,925 R196S probably benign Het
Vmn1r43 A T 6: 89,869,570 H311Q possibly damaging Het
Vmn1r54 A G 6: 90,270,027 T308A probably benign Het
Zfand3 T A 17: 30,135,505 Y99N probably benign Het
Zfp119b T C 17: 55,939,355 Y277C probably damaging Het
Zfp345 G A 2: 150,472,583 H345Y possibly damaging Het
Zyg11a T C 4: 108,189,729 E516G probably damaging Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 splice site probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R7923:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139882060 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139936056 missense unknown
R8724:Pik3c2g UTSW 6 139967893 missense unknown
R8733:Pik3c2g UTSW 6 139768700 nonsense probably null
R8809:Pik3c2g UTSW 6 139768710 missense
R8888:Pik3c2g UTSW 6 139730366 nonsense probably null
R8931:Pik3c2g UTSW 6 139875367 missense probably benign 0.02
R9188:Pik3c2g UTSW 6 139622403 missense possibly damaging 0.94
R9336:Pik3c2g UTSW 6 139875435 missense
R9524:Pik3c2g UTSW 6 139629770 missense probably damaging 0.99
R9531:Pik3c2g UTSW 6 139896200 missense
R9630:Pik3c2g UTSW 6 139622239 missense possibly damaging 0.66
R9697:Pik3c2g UTSW 6 139967791 missense unknown
R9708:Pik3c2g UTSW 6 139629867 missense probably benign
R9717:Pik3c2g UTSW 6 139896184 missense
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTATACCCACCACTAACTATGAGGG -3'
(R):5'- ATGGTTCTAGCTCTGCCACC -3'

Sequencing Primer
(F):5'- GCACAAAATTATGTCTGTTCATGCAG -3'
(R):5'- TAGCTCTGCCACCTTAATACCAATG -3'
Posted On 2022-04-18