Mutagenetix > Incidental Mutation

Incidental Mutation 'R9383:Chd2'

710152

Institutional Source

Beutler Lab

Gene Symbol

Chd2

Ensembl Gene

ENSMUSG00000078671

Gene Name

chromodomain helicase DNA binding protein 2

Synonyms

2810040A01Rik, 2810013C04Rik, 5630401D06Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001081345; Ensembl: ENSMUST00000169922; MGI: 2448567

Essential gene?

Possibly essential (E-score: 0.615) question?

Stock #

R9383 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

73426638-73541830 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73449170 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 1467 (E1467V)

Ref Sequence

ENSEMBL: ENSMUSP00000126352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169922] [ENSMUST00000181971]

AlphaFold

E9PZM4

Predicted Effect

probably null
Transcript: ENSMUST00000169922
AA Change: E1467V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: E1467V

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	176	196	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
CHROMO	260	346	3.64e-19	SMART
CHROMO	376	449	7.99e-16	SMART
DEXDc	480	677	1.93e-37	SMART
Blast:DEXDc	678	729	2e-18	BLAST
low complexity region	793	806	N/A	INTRINSIC
HELICc	821	905	1.2e-24	SMART
Blast:DEXDc	960	1244	4e-63	BLAST
PDB:4B4C\|A	1128	1316	5e-78	PDB
low complexity region	1317	1329	N/A	INTRINSIC
low complexity region	1338	1351	N/A	INTRINSIC
low complexity region	1389	1403	N/A	INTRINSIC
low complexity region	1407	1441	N/A	INTRINSIC
DUF4208	1451	1555	1.85e-52	SMART
low complexity region	1557	1572	N/A	INTRINSIC
low complexity region	1704	1729	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173785

SMART Domains

Protein: ENSMUSP00000133714
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
DUF4208	1	58	1.59e-4	SMART
low complexity region	60	75	N/A	INTRINSIC
low complexity region	147	163	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000181971

Predicted Effect

probably benign
Transcript: ENSMUST00000199809

Predicted Effect

probably benign
Transcript: ENSMUST00000208458

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]

Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg5	A	G	8: 94,934,534	E124G		Het
Atp1a2	T	C	1: 172,279,767	I729V	probably benign	Het
Col6a5	T	C	9: 105,925,911	D1285G	unknown	Het
Coro7	A	G	16: 4,635,024	C287R	probably damaging	Het
Cpa3	T	C	3: 20,228,881	E134G	probably benign	Het
Csf3r	C	T	4: 126,043,446	P708S	possibly damaging	Het
Ctgf	T	G	10: 24,595,985	V58G	possibly damaging	Het
Defb30	T	C	14: 63,036,014	E49G	probably benign	Het
Dnah3	A	T	7: 120,047,596	I1070K	probably benign	Het
Dnm2	G	A	9: 21,472,624	V234M	probably damaging	Het
Drg2	T	A	11: 60,459,461	M82K	probably benign	Het
Dus2	G	A	8: 106,050,318	E312K	probably benign	Het
Efcab6	T	C	15: 83,872,419	E1240G	possibly damaging	Het
Ep400	T	C	5: 110,685,485	E1957G	unknown	Het
Gpnmb	A	G	6: 49,051,984	S479G	probably damaging	Het
Gpr153	T	C	4: 152,283,059	S456P	probably benign	Het
Gprc5b	A	T	7: 118,976,538	M388K	probably damaging	Het
H2-T23	T	C	17: 36,032,335	D50G	possibly damaging	Het
Hipk1	T	C	3: 103,777,567	E244G	probably damaging	Het
Malrd1	T	A	2: 15,695,201	C620S	unknown	Het
Maz	G	A	7: 127,024,911	Q358*	probably null	Het
Mcc	A	T	18: 44,442,918	I901N	probably benign	Het
Megf11	T	G	9: 64,638,450	C172G	probably damaging	Het
Mipol1	A	G	12: 57,306,034	Y53C	probably benign	Het
Nectin4	C	T	1: 171,385,683	T391I	probably damaging	Het
Nell2	A	T	15: 95,385,076	Y362N	possibly damaging	Het
Nphp4	T	C	4: 152,544,461		probably null	Het
Nsun4	A	G	4: 116,034,276	V302A	probably benign	Het
Odf2	T	A	2: 29,901,237	L181H	probably damaging	Het
Olfr1076	T	C	2: 86,508,510	I17T	probably damaging	Het
Opn1sw	A	G	6: 29,378,001	S328P	possibly damaging	Het
Pga5	C	T	19: 10,669,533	G303S	probably damaging	Het
Pik3c2g	T	A	6: 139,882,016	Y712*	probably null	Het
Pkd1	C	T	17: 24,575,926	R2196C	probably damaging	Het
Pkd1l3	TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA	TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA	8: 109,623,969		probably benign	Het
Plekhm2	A	T	4: 141,632,301	M385K	probably damaging	Het
Pole	T	C	5: 110,291,026	V164A	possibly damaging	Het
Prr19	T	A	7: 25,302,910	F11Y	probably damaging	Het
Prtg	G	T	9: 72,849,861	L355F	probably benign	Het
Raph1	C	A	1: 60,525,670	M219I	unknown	Het
Rtkn2	A	G	10: 68,003,264	D140G	possibly damaging	Het
Serpina5	T	C	12: 104,103,872	S343P	probably damaging	Het
Slc1a1	A	G	19: 28,911,725	K466R	probably benign	Het
Slc43a1	G	A	2: 84,860,162	V518M	probably damaging	Het
Slc47a2	A	G	11: 61,336,923	L125P	probably damaging	Het
Slc4a7	C	A	14: 14,766,803	C585*	probably null	Het
Snx19	A	G	9: 30,435,900	E713G	probably damaging	Het
Tiam1	C	T	16: 89,858,673	V715M	probably damaging	Het
Tln2	T	A	9: 67,370,761	M322L	probably benign	Het
Top2a	G	A	11: 99,011,058	R449*	probably null	Het
Trpv4	C	A	5: 114,658,413		probably benign	Het
Vmn1r214	A	C	13: 23,034,925	R196S	probably benign	Het
Vmn1r43	A	T	6: 89,869,570	H311Q	possibly damaging	Het
Vmn1r54	A	G	6: 90,270,027	T308A	probably benign	Het
Zfand3	T	A	17: 30,135,505	Y99N	probably benign	Het
Zfp119b	T	C	17: 55,939,355	Y277C	probably damaging	Het
Zfp345	G	A	2: 150,472,583	H345Y	possibly damaging	Het
Zyg11a	T	C	4: 108,189,729	E516G	probably damaging	Het

Other mutations in Chd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Chd2	APN	7	73468577	missense	probably damaging	0.99
IGL00535:Chd2	APN	7	73540828	missense	probably benign	0.01
IGL00961:Chd2	APN	7	73444249	missense	probably damaging	0.99
IGL01092:Chd2	APN	7	73441686	missense	possibly damaging	0.69
IGL02035:Chd2	APN	7	73441627	splice site	probably null
IGL02083:Chd2	APN	7	73481068	missense	possibly damaging	0.95
IGL02205:Chd2	APN	7	73441717	missense	probably benign	0.01
IGL02243:Chd2	APN	7	73497708	splice site	probably null
IGL02385:Chd2	APN	7	73435822	missense	probably damaging	1.00
IGL02552:Chd2	APN	7	73447320	unclassified	probably benign
IGL02590:Chd2	APN	7	73453200	missense	probably benign	0.00
IGL02684:Chd2	APN	7	73475349	missense	probably damaging	0.99
IGL02731:Chd2	APN	7	73493456	missense	probably damaging	0.99
IGL03272:Chd2	APN	7	73453166	missense	possibly damaging	0.94
1mM(1):Chd2	UTSW	7	73502104	missense	possibly damaging	0.65
A4554:Chd2	UTSW	7	73480968	missense	probably benign
F6893:Chd2	UTSW	7	73507872	missense	possibly damaging	0.92
R0012:Chd2	UTSW	7	73455519	missense	probably damaging	1.00
R0012:Chd2	UTSW	7	73455519	missense	probably damaging	1.00
R0068:Chd2	UTSW	7	73484534	missense	probably damaging	1.00
R0763:Chd2	UTSW	7	73447274	missense	possibly damaging	0.74
R0973:Chd2	UTSW	7	73478664	missense	probably damaging	1.00
R0973:Chd2	UTSW	7	73478664	missense	probably damaging	1.00
R0974:Chd2	UTSW	7	73478664	missense	probably damaging	1.00
R1223:Chd2	UTSW	7	73484517	missense	probably damaging	1.00
R1435:Chd2	UTSW	7	73453136	missense	probably damaging	0.99
R1527:Chd2	UTSW	7	73490614	nonsense	probably null
R1599:Chd2	UTSW	7	73473051	missense	probably benign	0.05
R1657:Chd2	UTSW	7	73480430	missense	probably damaging	1.00
R1932:Chd2	UTSW	7	73454445	missense	probably damaging	0.99
R2110:Chd2	UTSW	7	73429987	missense	probably benign	0.00
R2202:Chd2	UTSW	7	73478668	missense	probably benign	0.00
R2383:Chd2	UTSW	7	73503420	missense	possibly damaging	0.89
R2393:Chd2	UTSW	7	73507883	missense	possibly damaging	0.92
R3699:Chd2	UTSW	7	73468490	missense	probably benign	0.35
R3713:Chd2	UTSW	7	73471790	unclassified	probably benign
R3788:Chd2	UTSW	7	73447130	unclassified	probably benign
R3826:Chd2	UTSW	7	73491415	missense	possibly damaging	0.71
R3828:Chd2	UTSW	7	73491415	missense	possibly damaging	0.71
R3830:Chd2	UTSW	7	73491415	missense	possibly damaging	0.71
R3966:Chd2	UTSW	7	73464395	splice site	probably benign
R4093:Chd2	UTSW	7	73501016	missense	possibly damaging	0.70
R4431:Chd2	UTSW	7	73435961	missense	possibly damaging	0.56
R4461:Chd2	UTSW	7	73540874	intron	probably benign
R4782:Chd2	UTSW	7	73484436	missense	possibly damaging	0.80
R4791:Chd2	UTSW	7	73468577	missense	probably benign	0.13
R4792:Chd2	UTSW	7	73468577	missense	probably benign	0.13
R4799:Chd2	UTSW	7	73484436	missense	possibly damaging	0.80
R4832:Chd2	UTSW	7	73502125	missense	probably damaging	1.00
R5055:Chd2	UTSW	7	73480508	missense	probably damaging	1.00
R5071:Chd2	UTSW	7	73429689	missense	probably benign	0.03
R5328:Chd2	UTSW	7	73463681	missense	possibly damaging	0.96
R5444:Chd2	UTSW	7	73473085	missense	probably damaging	1.00
R5643:Chd2	UTSW	7	73484484	missense	probably damaging	1.00
R5666:Chd2	UTSW	7	73441717	missense	probably benign	0.01
R5670:Chd2	UTSW	7	73441717	missense	probably benign	0.01
R5706:Chd2	UTSW	7	73491357	missense	possibly damaging	0.74
R5825:Chd2	UTSW	7	73484602	splice site	probably null
R5834:Chd2	UTSW	7	73478715	missense	probably damaging	1.00
R5920:Chd2	UTSW	7	73537312	missense	probably damaging	0.97
R6051:Chd2	UTSW	7	73435842	missense	probably benign	0.00
R6179:Chd2	UTSW	7	73444323	missense	probably damaging	0.98
R6229:Chd2	UTSW	7	73451723	missense	possibly damaging	0.76
R6267:Chd2	UTSW	7	73463671	missense	probably damaging	0.99
R6310:Chd2	UTSW	7	73453164	missense	probably damaging	1.00
R6439:Chd2	UTSW	7	73480406	missense	probably damaging	1.00
R6444:Chd2	UTSW	7	73501037	critical splice acceptor site	probably null
R6529:Chd2	UTSW	7	73503443	missense	possibly damaging	0.89
R6611:Chd2	UTSW	7	73493565	missense	probably damaging	0.99
R6661:Chd2	UTSW	7	73490482	missense	possibly damaging	0.95
R6782:Chd2	UTSW	7	73475379	nonsense	probably null
R6860:Chd2	UTSW	7	73497810	missense	possibly damaging	0.95
R6955:Chd2	UTSW	7	73475423	missense	probably damaging	1.00
R6984:Chd2	UTSW	7	73484411	nonsense	probably null
R7095:Chd2	UTSW	7	73471881	missense	probably damaging	1.00
R7121:Chd2	UTSW	7	73469670	missense	probably benign	0.00
R7179:Chd2	UTSW	7	73475420	missense	probably damaging	1.00
R7500:Chd2	UTSW	7	73451808	missense	probably damaging	1.00
R7615:Chd2	UTSW	7	73441642	missense	probably damaging	0.97
R7646:Chd2	UTSW	7	73435773	missense	possibly damaging	0.49
R7764:Chd2	UTSW	7	73471819	missense	probably null	1.00
R7898:Chd2	UTSW	7	73519475	critical splice donor site	probably null
R7935:Chd2	UTSW	7	73499625	missense	probably benign	0.01
R8033:Chd2	UTSW	7	73435880	missense	probably damaging	1.00
R8070:Chd2	UTSW	7	73451758	missense	probably benign
R8071:Chd2	UTSW	7	73537384	missense	probably benign
R8188:Chd2	UTSW	7	73429756	nonsense	probably null
R8196:Chd2	UTSW	7	73468537	missense	probably benign	0.00
R8258:Chd2	UTSW	7	73435784	missense	probably benign	0.11
R8259:Chd2	UTSW	7	73435784	missense	probably benign	0.11
R8357:Chd2	UTSW	7	73447237	missense	probably damaging	0.99
R8457:Chd2	UTSW	7	73447237	missense	probably damaging	0.99
R8778:Chd2	UTSW	7	73429735	missense	possibly damaging	0.88
R8816:Chd2	UTSW	7	73490497	missense	probably damaging	1.00
R8875:Chd2	UTSW	7	73502035	missense	probably damaging	1.00
R8935:Chd2	UTSW	7	73503462	missense	possibly damaging	0.47
R9005:Chd2	UTSW	7	73484546	missense	probably damaging	0.98
R9009:Chd2	UTSW	7	73490654	missense	probably benign	0.12
R9009:Chd2	UTSW	7	73493444	missense	probably benign	0.39
R9021:Chd2	UTSW	7	73441645	missense	probably benign	0.03
R9038:Chd2	UTSW	7	73455610	missense	probably damaging	1.00
R9064:Chd2	UTSW	7	73493531	missense	possibly damaging	0.70
R9501:Chd2	UTSW	7	73441733	missense	possibly damaging	0.92
R9501:Chd2	UTSW	7	73480546	missense	probably damaging	1.00
R9550:Chd2	UTSW	7	73469691	missense	probably damaging	0.99
R9583:Chd2	UTSW	7	73480482	missense	probably damaging	0.99
R9665:Chd2	UTSW	7	73429807	missense	probably benign	0.00
RF009:Chd2	UTSW	7	73519662	missense	possibly damaging	0.73
X0025:Chd2	UTSW	7	73507837	missense	probably benign	0.11
Z1177:Chd2	UTSW	7	73468586	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- CTACTGGTTCAGCCTACAATCTG -3'
(R):5'- TGAGGTCATCATTTCCCTGC -3'

Sequencing Primer
(F):5'- CTGGTTCAGCCTACAATCTGTAAAC -3'
(R):5'- TAGCAAAGCACTGGTCTTGC -3'

Posted On

2022-04-18