Mutagenetix > Incidental Mutation

Incidental Mutation 'R9383:Tln2'

710162

Institutional Source

Beutler Lab

Gene Symbol

Tln2

Ensembl Gene

ENSMUSG00000052698

Gene Name

talin 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.208) question?

Stock #

R9383 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

67217087-67559703 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67370761 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 322 (M322L)

Ref Sequence

ENSEMBL: ENSMUSP00000035272 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215784]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000039662
AA Change: M322L

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: M322L

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	3.4e-59	PFAM
Pfam:I_LWEQ	661	765	1.9e-10	PFAM
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	2.6e-67	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2384	2531	2.5e-52	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000040025
AA Change: M322L

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: M322L

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	8.5e-78	PFAM
low complexity region	674	693	N/A	INTRINSIC
internal_repeat_2	703	763	2.05e-7	PROSPERO
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	9.9e-72	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2383	2533	4.3e-51	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215784
AA Change: M324L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg5	A	G	8: 94,934,534	E124G		Het
Atp1a2	T	C	1: 172,279,767	I729V	probably benign	Het
Chd2	T	A	7: 73,449,170	E1467V	probably null	Het
Col6a5	T	C	9: 105,925,911	D1285G	unknown	Het
Coro7	A	G	16: 4,635,024	C287R	probably damaging	Het
Cpa3	T	C	3: 20,228,881	E134G	probably benign	Het
Csf3r	C	T	4: 126,043,446	P708S	possibly damaging	Het
Ctgf	T	G	10: 24,595,985	V58G	possibly damaging	Het
Defb30	T	C	14: 63,036,014	E49G	probably benign	Het
Dnah3	A	T	7: 120,047,596	I1070K	probably benign	Het
Dnm2	G	A	9: 21,472,624	V234M	probably damaging	Het
Drg2	T	A	11: 60,459,461	M82K	probably benign	Het
Dus2	G	A	8: 106,050,318	E312K	probably benign	Het
Efcab6	T	C	15: 83,872,419	E1240G	possibly damaging	Het
Ep400	T	C	5: 110,685,485	E1957G	unknown	Het
Gpnmb	A	G	6: 49,051,984	S479G	probably damaging	Het
Gpr153	T	C	4: 152,283,059	S456P	probably benign	Het
Gprc5b	A	T	7: 118,976,538	M388K	probably damaging	Het
H2-T23	T	C	17: 36,032,335	D50G	possibly damaging	Het
Hipk1	T	C	3: 103,777,567	E244G	probably damaging	Het
Malrd1	T	A	2: 15,695,201	C620S	unknown	Het
Maz	G	A	7: 127,024,911	Q358*	probably null	Het
Mcc	A	T	18: 44,442,918	I901N	probably benign	Het
Megf11	T	G	9: 64,638,450	C172G	probably damaging	Het
Mipol1	A	G	12: 57,306,034	Y53C	probably benign	Het
Nectin4	C	T	1: 171,385,683	T391I	probably damaging	Het
Nell2	A	T	15: 95,385,076	Y362N	possibly damaging	Het
Nphp4	T	C	4: 152,544,461		probably null	Het
Nsun4	A	G	4: 116,034,276	V302A	probably benign	Het
Odf2	T	A	2: 29,901,237	L181H	probably damaging	Het
Olfr1076	T	C	2: 86,508,510	I17T	probably damaging	Het
Opn1sw	A	G	6: 29,378,001	S328P	possibly damaging	Het
Pga5	C	T	19: 10,669,533	G303S	probably damaging	Het
Pik3c2g	T	A	6: 139,882,016	Y712*	probably null	Het
Pkd1	C	T	17: 24,575,926	R2196C	probably damaging	Het
Pkd1l3	TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA	TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA	8: 109,623,969		probably benign	Het
Plekhm2	A	T	4: 141,632,301	M385K	probably damaging	Het
Pole	T	C	5: 110,291,026	V164A	possibly damaging	Het
Prr19	T	A	7: 25,302,910	F11Y	probably damaging	Het
Prtg	G	T	9: 72,849,861	L355F	probably benign	Het
Raph1	C	A	1: 60,525,670	M219I	unknown	Het
Rtkn2	A	G	10: 68,003,264	D140G	possibly damaging	Het
Serpina5	T	C	12: 104,103,872	S343P	probably damaging	Het
Slc1a1	A	G	19: 28,911,725	K466R	probably benign	Het
Slc43a1	G	A	2: 84,860,162	V518M	probably damaging	Het
Slc47a2	A	G	11: 61,336,923	L125P	probably damaging	Het
Slc4a7	C	A	14: 14,766,803	C585*	probably null	Het
Snx19	A	G	9: 30,435,900	E713G	probably damaging	Het
Tiam1	C	T	16: 89,858,673	V715M	probably damaging	Het
Top2a	G	A	11: 99,011,058	R449*	probably null	Het
Trpv4	C	A	5: 114,658,413		probably benign	Het
Vmn1r214	A	C	13: 23,034,925	R196S	probably benign	Het
Vmn1r43	A	T	6: 89,869,570	H311Q	possibly damaging	Het
Vmn1r54	A	G	6: 90,270,027	T308A	probably benign	Het
Zfand3	T	A	17: 30,135,505	Y99N	probably benign	Het
Zfp119b	T	C	17: 55,939,355	Y277C	probably damaging	Het
Zfp345	G	A	2: 150,472,583	H345Y	possibly damaging	Het
Zyg11a	T	C	4: 108,189,729	E516G	probably damaging	Het

Other mutations in Tln2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Tln2	APN	9	67344187	missense	possibly damaging	0.59
IGL01110:Tln2	APN	9	67250582	nonsense	probably null
IGL01112:Tln2	APN	9	67311811	missense	probably damaging	1.00
IGL01307:Tln2	APN	9	67395467	missense	probably benign	0.25
IGL01374:Tln2	APN	9	67261923	missense	probably damaging	1.00
IGL01625:Tln2	APN	9	67370623	missense	probably damaging	1.00
IGL01865:Tln2	APN	9	67250614	nonsense	probably null
IGL01999:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02002:Tln2	APN	9	67356698	missense	probably damaging	0.98
IGL02005:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02015:Tln2	APN	9	67361439	splice site	probably benign
IGL02368:Tln2	APN	9	67240810	splice site	probably benign
IGL02444:Tln2	APN	9	67258592	splice site	probably benign
IGL02646:Tln2	APN	9	67255996	missense	probably benign	0.43
IGL02744:Tln2	APN	9	67229376	nonsense	probably null
IGL02869:Tln2	APN	9	67221525	splice site	probably benign
IGL02930:Tln2	APN	9	67393662	nonsense	probably null
IGL03100:Tln2	APN	9	67295737	missense	probably damaging	1.00
IGL03326:Tln2	APN	9	67334257	missense	possibly damaging	0.67
Harrier	UTSW	9	67330552	nonsense	probably null
Marsh	UTSW	9	67272654	missense	probably benign	0.19
BB008:Tln2	UTSW	9	67258460	critical splice donor site	probably null
BB018:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0107:Tln2	UTSW	9	67370706	missense	probably damaging	1.00
R0494:Tln2	UTSW	9	67355197	missense	probably benign	0.22
R0884:Tln2	UTSW	9	67370733	missense	probably damaging	1.00
R0947:Tln2	UTSW	9	67295813	missense	probably benign	0.08
R0989:Tln2	UTSW	9	67229454	missense	probably damaging	1.00
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1486:Tln2	UTSW	9	67311839	missense	probably damaging	1.00
R1527:Tln2	UTSW	9	67272668	missense	possibly damaging	0.95
R1584:Tln2	UTSW	9	67296414	missense	probably damaging	1.00
R1636:Tln2	UTSW	9	67306532	missense	probably damaging	1.00
R1656:Tln2	UTSW	9	67227107	missense	possibly damaging	0.81
R1707:Tln2	UTSW	9	67375807	missense	probably benign	0.00
R1749:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1751:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1761:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1767:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1815:Tln2	UTSW	9	67229423	missense	probably damaging	1.00
R1840:Tln2	UTSW	9	67342043	missense	probably damaging	1.00
R1847:Tln2	UTSW	9	67362687	nonsense	probably null
R1964:Tln2	UTSW	9	67342135	missense	probably benign	0.00
R1968:Tln2	UTSW	9	67255901	missense	probably damaging	1.00
R2036:Tln2	UTSW	9	67272704	missense	possibly damaging	0.76
R2038:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R2152:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2153:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2154:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2191:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2192:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2201:Tln2	UTSW	9	67375757	missense	probably damaging	1.00
R3116:Tln2	UTSW	9	67355139	missense	probably benign	0.10
R3151:Tln2	UTSW	9	67330547	critical splice donor site	probably null
R3795:Tln2	UTSW	9	67255915	missense	probably damaging	0.97
R3953:Tln2	UTSW	9	67370629	missense	probably damaging	1.00
R4450:Tln2	UTSW	9	67344065	critical splice donor site	probably null
R4685:Tln2	UTSW	9	67302572	missense	probably damaging	1.00
R4688:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R4696:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4697:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4700:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4701:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4741:Tln2	UTSW	9	67386555	critical splice donor site	probably null
R4806:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4807:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4808:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4967:Tln2	UTSW	9	67355125	missense	probably damaging	0.97
R5061:Tln2	UTSW	9	67354468	missense	probably benign
R5092:Tln2	UTSW	9	67256028	missense	probably benign	0.13
R5093:Tln2	UTSW	9	67334314	missense	probably benign	0.44
R5126:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R5204:Tln2	UTSW	9	67354482	missense	probably benign	0.00
R5236:Tln2	UTSW	9	67365923	missense	probably damaging	0.99
R5287:Tln2	UTSW	9	67242359	missense	probably damaging	1.00
R5568:Tln2	UTSW	9	67311865	missense	probably damaging	1.00
R5571:Tln2	UTSW	9	67334320	missense	possibly damaging	0.88
R5642:Tln2	UTSW	9	67296358	missense	probably benign	0.01
R5711:Tln2	UTSW	9	67392547	missense	probably benign	0.00
R5776:Tln2	UTSW	9	67258250	missense	probably damaging	1.00
R5791:Tln2	UTSW	9	67386605	missense	probably damaging	0.98
R5866:Tln2	UTSW	9	67266868	missense	probably damaging	1.00
R5888:Tln2	UTSW	9	67229403	missense	probably damaging	1.00
R5902:Tln2	UTSW	9	67362717	missense	probably benign	0.02
R6106:Tln2	UTSW	9	67323020	missense	probably damaging	0.99
R6175:Tln2	UTSW	9	67224081	missense	probably damaging	1.00
R6385:Tln2	UTSW	9	67278129	missense	probably benign	0.45
R6430:Tln2	UTSW	9	67272665	missense	probably damaging	1.00
R6441:Tln2	UTSW	9	67272689	missense	probably damaging	1.00
R6738:Tln2	UTSW	9	67386664	missense	possibly damaging	0.91
R6776:Tln2	UTSW	9	67262905	missense	probably damaging	1.00
R6794:Tln2	UTSW	9	67286558	missense	probably benign	0.07
R6850:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R6907:Tln2	UTSW	9	67397635	missense	probably damaging	0.98
R6909:Tln2	UTSW	9	67392532	missense	probably damaging	0.97
R6951:Tln2	UTSW	9	67258485	missense	probably damaging	0.97
R7015:Tln2	UTSW	9	67362647	missense	possibly damaging	0.55
R7051:Tln2	UTSW	9	67346417	missense	probably benign	0.00
R7246:Tln2	UTSW	9	67262979	missense	probably damaging	1.00
R7292:Tln2	UTSW	9	67346461	missense	probably benign
R7753:Tln2	UTSW	9	67395473	missense	probably damaging	1.00
R7868:Tln2	UTSW	9	67348226	missense	probably damaging	1.00
R7931:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R8023:Tln2	UTSW	9	67224064	missense	probably damaging	1.00
R8081:Tln2	UTSW	9	67356747	missense	probably damaging	1.00
R8164:Tln2	UTSW	9	67319420	missense	probably benign	0.31
R8192:Tln2	UTSW	9	67346529	nonsense	probably null
R8495:Tln2	UTSW	9	67354467	missense	probably benign	0.01
R8734:Tln2	UTSW	9	67272654	missense	probably benign	0.19
R8739:Tln2	UTSW	9	67258273	missense	probably damaging	1.00
R8757:Tln2	UTSW	9	67367218	missense	probably damaging	1.00
R8759:Tln2	UTSW	9	67367218	missense	probably damaging	1.00
R8770:Tln2	UTSW	9	67323022	missense	probably benign
R8781:Tln2	UTSW	9	67255951	missense	probably damaging	1.00
R8812:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8814:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8816:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8816:Tln2	UTSW	9	67221517	missense	probably damaging	1.00
R8833:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8835:Tln2	UTSW	9	67397693	splice site	probably benign
R8837:Tln2	UTSW	9	67250584	missense	probably damaging	0.99
R8843:Tln2	UTSW	9	67395545	missense	probably damaging	1.00
R8864:Tln2	UTSW	9	67330552	nonsense	probably null
R8867:Tln2	UTSW	9	67330550	missense	probably damaging	0.98
R8921:Tln2	UTSW	9	67266823	missense	probably damaging	0.99
R9080:Tln2	UTSW	9	67346561	missense	probably damaging	1.00
R9083:Tln2	UTSW	9	67362645	missense	probably damaging	0.96
R9150:Tln2	UTSW	9	67221496	missense	probably damaging	1.00
R9287:Tln2	UTSW	9	67370698	missense	probably benign	0.20
R9330:Tln2	UTSW	9	67321931	missense	possibly damaging	0.61
R9343:Tln2	UTSW	9	67323071	missense	probably benign	0.10
R9355:Tln2	UTSW	9	67355247	missense	possibly damaging	0.46
R9386:Tln2	UTSW	9	67365967	missense	possibly damaging	0.78
R9407:Tln2	UTSW	9	67229450	missense	probably damaging	1.00
R9483:Tln2	UTSW	9	67392487	missense	probably damaging	1.00
R9523:Tln2	UTSW	9	67258484	missense	probably damaging	0.99
R9642:Tln2	UTSW	9	67250544	missense	probably benign	0.02
R9703:Tln2	UTSW	9	67386656	missense	probably damaging	1.00
X0027:Tln2	UTSW	9	67376853	missense	probably damaging	1.00
X0064:Tln2	UTSW	9	67348138	missense	probably damaging	1.00
X0067:Tln2	UTSW	9	67370691	missense	probably damaging	1.00
Z1176:Tln2	UTSW	9	67346485	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- TGAATAATACCCACAGGCTGCC -3'
(R):5'- TCCAGGAAACAGCACACCTTTG -3'

Sequencing Primer
(F):5'- CACCAGTCCCCTCAGTGC -3'
(R):5'- ACACCTTTGTGAATCTGTCCAG -3'

Posted On

2022-04-18