Incidental Mutation 'R9383:Slc47a2'
ID 710168
Institutional Source Beutler Lab
Gene Symbol Slc47a2
Ensembl Gene ENSMUSG00000069855
Gene Name solute carrier family 47, member 2
Synonyms 4933429E10Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9383 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 61301631-61342860 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 61336923 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 125 (L125P)
Ref Sequence ENSEMBL: ENSMUSP00000090710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093029] [ENSMUST00000134423]
AlphaFold Q3V050
Predicted Effect probably damaging
Transcript: ENSMUST00000093029
AA Change: L125P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090710
Gene: ENSMUSG00000069855
AA Change: L125P

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
Pfam:MatE 53 213 1.7e-35 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Pfam:MatE 274 435 4e-34 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 545 567 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134423
AA Change: L125P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120907
Gene: ENSMUSG00000069855
AA Change: L125P

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
Pfam:MatE 53 213 3.5e-32 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Pfam:MatE 274 435 1.7e-36 PFAM
transmembrane domain 444 466 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 A G 8: 94,934,534 E124G Het
Atp1a2 T C 1: 172,279,767 I729V probably benign Het
Chd2 T A 7: 73,449,170 E1467V probably null Het
Col6a5 T C 9: 105,925,911 D1285G unknown Het
Coro7 A G 16: 4,635,024 C287R probably damaging Het
Cpa3 T C 3: 20,228,881 E134G probably benign Het
Csf3r C T 4: 126,043,446 P708S possibly damaging Het
Ctgf T G 10: 24,595,985 V58G possibly damaging Het
Defb30 T C 14: 63,036,014 E49G probably benign Het
Dnah3 A T 7: 120,047,596 I1070K probably benign Het
Dnm2 G A 9: 21,472,624 V234M probably damaging Het
Drg2 T A 11: 60,459,461 M82K probably benign Het
Dus2 G A 8: 106,050,318 E312K probably benign Het
Efcab6 T C 15: 83,872,419 E1240G possibly damaging Het
Ep400 T C 5: 110,685,485 E1957G unknown Het
Gpnmb A G 6: 49,051,984 S479G probably damaging Het
Gpr153 T C 4: 152,283,059 S456P probably benign Het
Gprc5b A T 7: 118,976,538 M388K probably damaging Het
H2-T23 T C 17: 36,032,335 D50G possibly damaging Het
Hipk1 T C 3: 103,777,567 E244G probably damaging Het
Malrd1 T A 2: 15,695,201 C620S unknown Het
Maz G A 7: 127,024,911 Q358* probably null Het
Mcc A T 18: 44,442,918 I901N probably benign Het
Megf11 T G 9: 64,638,450 C172G probably damaging Het
Mipol1 A G 12: 57,306,034 Y53C probably benign Het
Nectin4 C T 1: 171,385,683 T391I probably damaging Het
Nell2 A T 15: 95,385,076 Y362N possibly damaging Het
Nphp4 T C 4: 152,544,461 probably null Het
Nsun4 A G 4: 116,034,276 V302A probably benign Het
Odf2 T A 2: 29,901,237 L181H probably damaging Het
Olfr1076 T C 2: 86,508,510 I17T probably damaging Het
Opn1sw A G 6: 29,378,001 S328P possibly damaging Het
Pga5 C T 19: 10,669,533 G303S probably damaging Het
Pik3c2g T A 6: 139,882,016 Y712* probably null Het
Pkd1 C T 17: 24,575,926 R2196C probably damaging Het
Pkd1l3 TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA 8: 109,623,969 probably benign Het
Plekhm2 A T 4: 141,632,301 M385K probably damaging Het
Pole T C 5: 110,291,026 V164A possibly damaging Het
Prr19 T A 7: 25,302,910 F11Y probably damaging Het
Prtg G T 9: 72,849,861 L355F probably benign Het
Raph1 C A 1: 60,525,670 M219I unknown Het
Rtkn2 A G 10: 68,003,264 D140G possibly damaging Het
Serpina5 T C 12: 104,103,872 S343P probably damaging Het
Slc1a1 A G 19: 28,911,725 K466R probably benign Het
Slc43a1 G A 2: 84,860,162 V518M probably damaging Het
Slc4a7 C A 14: 14,766,803 C585* probably null Het
Snx19 A G 9: 30,435,900 E713G probably damaging Het
Tiam1 C T 16: 89,858,673 V715M probably damaging Het
Tln2 T A 9: 67,370,761 M322L probably benign Het
Top2a G A 11: 99,011,058 R449* probably null Het
Trpv4 C A 5: 114,658,413 probably benign Het
Vmn1r214 A C 13: 23,034,925 R196S probably benign Het
Vmn1r43 A T 6: 89,869,570 H311Q possibly damaging Het
Vmn1r54 A G 6: 90,270,027 T308A probably benign Het
Zfand3 T A 17: 30,135,505 Y99N probably benign Het
Zfp119b T C 17: 55,939,355 Y277C probably damaging Het
Zfp345 G A 2: 150,472,583 H345Y possibly damaging Het
Zyg11a T C 4: 108,189,729 E516G probably damaging Het
Other mutations in Slc47a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Slc47a2 APN 11 61302233 missense probably benign 0.16
IGL01367:Slc47a2 APN 11 61329781 missense probably benign 0.03
IGL01681:Slc47a2 APN 11 61338040 missense probably damaging 1.00
IGL01874:Slc47a2 APN 11 61312859 critical splice acceptor site probably null
IGL02049:Slc47a2 APN 11 61342539 missense probably damaging 0.98
IGL02399:Slc47a2 APN 11 61302194 unclassified probably benign
IGL02481:Slc47a2 APN 11 61336241 missense possibly damaging 0.58
IGL02880:Slc47a2 APN 11 61307540 missense probably damaging 0.97
IGL03068:Slc47a2 APN 11 61303943 missense probably damaging 1.00
IGL03136:Slc47a2 APN 11 61310765 missense probably benign 0.00
IGL03236:Slc47a2 APN 11 61313679 missense probably damaging 1.00
IGL03286:Slc47a2 APN 11 61342467 missense possibly damaging 0.57
R0047:Slc47a2 UTSW 11 61336242 missense possibly damaging 0.90
R0047:Slc47a2 UTSW 11 61336242 missense possibly damaging 0.90
R0597:Slc47a2 UTSW 11 61309976 missense probably damaging 0.98
R0690:Slc47a2 UTSW 11 61342504 missense possibly damaging 0.62
R2042:Slc47a2 UTSW 11 61338082 missense probably benign 0.05
R2217:Slc47a2 UTSW 11 61313671 missense probably benign 0.00
R2218:Slc47a2 UTSW 11 61313671 missense probably benign 0.00
R2271:Slc47a2 UTSW 11 61328526 critical splice donor site probably null
R2272:Slc47a2 UTSW 11 61328526 critical splice donor site probably null
R4067:Slc47a2 UTSW 11 61303947 missense probably benign 0.00
R4861:Slc47a2 UTSW 11 61336233 missense probably benign 0.00
R4861:Slc47a2 UTSW 11 61336233 missense probably benign 0.00
R4862:Slc47a2 UTSW 11 61313694 missense possibly damaging 0.69
R4985:Slc47a2 UTSW 11 61302233 missense probably benign
R5419:Slc47a2 UTSW 11 61307586 missense probably benign
R5593:Slc47a2 UTSW 11 61342660 missense probably benign 0.00
R7105:Slc47a2 UTSW 11 61342443 missense probably benign 0.07
R7358:Slc47a2 UTSW 11 61308873 missense possibly damaging 0.78
R7522:Slc47a2 UTSW 11 61302250 missense probably benign 0.14
R8743:Slc47a2 UTSW 11 61342762 missense probably benign 0.03
R8916:Slc47a2 UTSW 11 61302292 missense probably damaging 1.00
R9060:Slc47a2 UTSW 11 61336873 missense probably benign 0.00
R9484:Slc47a2 UTSW 11 61336234 missense possibly damaging 0.46
Z1176:Slc47a2 UTSW 11 61325889 missense probably benign 0.28
Z1177:Slc47a2 UTSW 11 61328575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTTACTTTGTGGCCAC -3'
(R):5'- GCCAAGGTATCAGTTGGCTG -3'

Sequencing Primer
(F):5'- ACTGTCACAGCGTCTGGTC -3'
(R):5'- TGGGACCTGGCAGCCATAATC -3'
Posted On 2022-04-18