Mutagenetix > Incidental Mutation

Incidental Mutation 'R9383:Serpina5'

710171

Institutional Source

Beutler Lab

Gene Symbol

Serpina5

Ensembl Gene

ENSMUSG00000041550

Gene Name

serine (or cysteine) peptidase inhibitor, clade A, member 5

Synonyms

alpha-1 antiproteinase, Pci, PAI-3, antitrypsin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9383 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

104101113-104106137 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104103872 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 343 (S343P)

Ref Sequence

ENSEMBL: ENSMUSP00000021495 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021495]

AlphaFold

P70458

Predicted Effect

probably damaging
Transcript: ENSMUST00000021495
AA Change: S343P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021495
Gene: ENSMUSG00000041550
AA Change: S343P

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SERPIN	48	405	1.4e-160	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. This gene is one in a cluster of serpin genes located on the q arm of chromosome 14. This family member is a glycoprotein that can inhibit several serine proteases, including protein C and various plasminogen activators and kallikreins, and it thus plays diverse roles in hemostasis and thrombosis in multiple organs. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene are phenotypically normal with the exception that males are infertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg5	A	G	8: 94,934,534	E124G		Het
Atp1a2	T	C	1: 172,279,767	I729V	probably benign	Het
Chd2	T	A	7: 73,449,170	E1467V	probably null	Het
Col6a5	T	C	9: 105,925,911	D1285G	unknown	Het
Coro7	A	G	16: 4,635,024	C287R	probably damaging	Het
Cpa3	T	C	3: 20,228,881	E134G	probably benign	Het
Csf3r	C	T	4: 126,043,446	P708S	possibly damaging	Het
Ctgf	T	G	10: 24,595,985	V58G	possibly damaging	Het
Defb30	T	C	14: 63,036,014	E49G	probably benign	Het
Dnah3	A	T	7: 120,047,596	I1070K	probably benign	Het
Dnm2	G	A	9: 21,472,624	V234M	probably damaging	Het
Drg2	T	A	11: 60,459,461	M82K	probably benign	Het
Dus2	G	A	8: 106,050,318	E312K	probably benign	Het
Efcab6	T	C	15: 83,872,419	E1240G	possibly damaging	Het
Ep400	T	C	5: 110,685,485	E1957G	unknown	Het
Gpnmb	A	G	6: 49,051,984	S479G	probably damaging	Het
Gpr153	T	C	4: 152,283,059	S456P	probably benign	Het
Gprc5b	A	T	7: 118,976,538	M388K	probably damaging	Het
H2-T23	T	C	17: 36,032,335	D50G	possibly damaging	Het
Hipk1	T	C	3: 103,777,567	E244G	probably damaging	Het
Malrd1	T	A	2: 15,695,201	C620S	unknown	Het
Maz	G	A	7: 127,024,911	Q358*	probably null	Het
Mcc	A	T	18: 44,442,918	I901N	probably benign	Het
Megf11	T	G	9: 64,638,450	C172G	probably damaging	Het
Mipol1	A	G	12: 57,306,034	Y53C	probably benign	Het
Nectin4	C	T	1: 171,385,683	T391I	probably damaging	Het
Nell2	A	T	15: 95,385,076	Y362N	possibly damaging	Het
Nphp4	T	C	4: 152,544,461		probably null	Het
Nsun4	A	G	4: 116,034,276	V302A	probably benign	Het
Odf2	T	A	2: 29,901,237	L181H	probably damaging	Het
Olfr1076	T	C	2: 86,508,510	I17T	probably damaging	Het
Opn1sw	A	G	6: 29,378,001	S328P	possibly damaging	Het
Pga5	C	T	19: 10,669,533	G303S	probably damaging	Het
Pik3c2g	T	A	6: 139,882,016	Y712*	probably null	Het
Pkd1	C	T	17: 24,575,926	R2196C	probably damaging	Het
Pkd1l3	TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA	TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA	8: 109,623,969		probably benign	Het
Plekhm2	A	T	4: 141,632,301	M385K	probably damaging	Het
Pole	T	C	5: 110,291,026	V164A	possibly damaging	Het
Prr19	T	A	7: 25,302,910	F11Y	probably damaging	Het
Prtg	G	T	9: 72,849,861	L355F	probably benign	Het
Raph1	C	A	1: 60,525,670	M219I	unknown	Het
Rtkn2	A	G	10: 68,003,264	D140G	possibly damaging	Het
Slc1a1	A	G	19: 28,911,725	K466R	probably benign	Het
Slc43a1	G	A	2: 84,860,162	V518M	probably damaging	Het
Slc47a2	A	G	11: 61,336,923	L125P	probably damaging	Het
Slc4a7	C	A	14: 14,766,803	C585*	probably null	Het
Snx19	A	G	9: 30,435,900	E713G	probably damaging	Het
Tiam1	C	T	16: 89,858,673	V715M	probably damaging	Het
Tln2	T	A	9: 67,370,761	M322L	probably benign	Het
Top2a	G	A	11: 99,011,058	R449*	probably null	Het
Trpv4	C	A	5: 114,658,413		probably benign	Het
Vmn1r214	A	C	13: 23,034,925	R196S	probably benign	Het
Vmn1r43	A	T	6: 89,869,570	H311Q	possibly damaging	Het
Vmn1r54	A	G	6: 90,270,027	T308A	probably benign	Het
Zfand3	T	A	17: 30,135,505	Y99N	probably benign	Het
Zfp119b	T	C	17: 55,939,355	Y277C	probably damaging	Het
Zfp345	G	A	2: 150,472,583	H345Y	possibly damaging	Het
Zyg11a	T	C	4: 108,189,729	E516G	probably damaging	Het

Other mutations in Serpina5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Serpina5	APN	12	104105220	missense	probably damaging	1.00
IGL01138:Serpina5	APN	12	104103744	missense	possibly damaging	0.60
IGL01526:Serpina5	APN	12	104101890	missense	probably damaging	1.00
IGL02159:Serpina5	APN	12	104105298	missense	possibly damaging	0.95
IGL02351:Serpina5	APN	12	104102125	missense	probably damaging	1.00
IGL02358:Serpina5	APN	12	104102125	missense	probably damaging	1.00
IGL02735:Serpina5	APN	12	104103857	missense	probably benign	0.21
IGL03087:Serpina5	APN	12	104101733	missense	probably benign	0.01
R0189:Serpina5	UTSW	12	104103330	missense	probably damaging	1.00
R0304:Serpina5	UTSW	12	104103200	missense	possibly damaging	0.76
R0492:Serpina5	UTSW	12	104102133	missense	probably damaging	1.00
R0511:Serpina5	UTSW	12	104103362	missense	probably benign	0.00
R0611:Serpina5	UTSW	12	104103787	missense	probably benign
R1016:Serpina5	UTSW	12	104105323	missense	probably damaging	0.97
R1649:Serpina5	UTSW	12	104105225	missense	possibly damaging	0.94
R1970:Serpina5	UTSW	12	104103857	missense	probably benign	0.02
R4429:Serpina5	UTSW	12	104103406	missense	probably benign	0.00
R4805:Serpina5	UTSW	12	104102201	missense	probably damaging	0.97
R5608:Serpina5	UTSW	12	104103744	missense	probably damaging	1.00
R6226:Serpina5	UTSW	12	104101778	missense	possibly damaging	0.72
R7097:Serpina5	UTSW	12	104102295	critical splice donor site	probably null
R7357:Serpina5	UTSW	12	104103380	missense	possibly damaging	0.85
R8208:Serpina5	UTSW	12	104105273	missense	probably benign	0.00
R9337:Serpina5	UTSW	12	104105283	missense	possibly damaging	0.92
R9526:Serpina5	UTSW	12	104103144	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTCATGGTGTCTAAGAATGACC -3'
(R):5'- GAAGACTATGAGATGCCTGCAG -3'

Sequencing Primer
(F):5'- CATGGTGTCTAAGAATGACCTTCTG -3'
(R):5'- TAATGGGATACTCTCTGAAATGGG -3'

Posted On

2022-04-18