Incidental Mutation 'R9383:Zfp119b'
ID 710182
Institutional Source Beutler Lab
Gene Symbol Zfp119b
Ensembl Gene ENSMUSG00000062101
Gene Name zinc finger protein 119b
Synonyms BC031441
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R9383 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 55938381-55949500 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55939355 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 277 (Y277C)
Ref Sequence ENSEMBL: ENSMUSP00000058300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056147] [ENSMUST00000189452]
AlphaFold Q8K0G9
Predicted Effect probably damaging
Transcript: ENSMUST00000056147
AA Change: Y277C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058300
Gene: ENSMUSG00000062101
AA Change: Y277C

DomainStartEndE-ValueType
KRAB 4 56 2e-14 SMART
ZnF_C2H2 155 175 2.82e1 SMART
ZnF_C2H2 287 309 1.1e-2 SMART
ZnF_C2H2 315 337 2.24e-3 SMART
ZnF_C2H2 343 365 5.14e-3 SMART
ZnF_C2H2 371 393 4.79e-3 SMART
ZnF_C2H2 399 421 1.12e-3 SMART
ZnF_C2H2 427 449 5.14e-3 SMART
ZnF_C2H2 455 477 7.37e-4 SMART
ZnF_C2H2 483 505 4.87e-4 SMART
ZnF_C2H2 511 533 1.25e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189452
AA Change: Y245C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139791
Gene: ENSMUSG00000062101
AA Change: Y245C

DomainStartEndE-ValueType
Blast:KRAB 1 34 8e-11 BLAST
ZnF_C2H2 123 143 1.2e-1 SMART
ZnF_C2H2 255 277 4.7e-5 SMART
ZnF_C2H2 283 305 9.1e-6 SMART
ZnF_C2H2 311 333 2.2e-5 SMART
ZnF_C2H2 339 361 2e-5 SMART
ZnF_C2H2 367 389 4.7e-6 SMART
ZnF_C2H2 395 417 2.1e-5 SMART
ZnF_C2H2 423 445 3.2e-6 SMART
ZnF_C2H2 451 473 2e-6 SMART
ZnF_C2H2 479 501 5.2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 A G 8: 94,934,534 E124G Het
Atp1a2 T C 1: 172,279,767 I729V probably benign Het
Chd2 T A 7: 73,449,170 E1467V probably null Het
Col6a5 T C 9: 105,925,911 D1285G unknown Het
Coro7 A G 16: 4,635,024 C287R probably damaging Het
Cpa3 T C 3: 20,228,881 E134G probably benign Het
Csf3r C T 4: 126,043,446 P708S possibly damaging Het
Ctgf T G 10: 24,595,985 V58G possibly damaging Het
Defb30 T C 14: 63,036,014 E49G probably benign Het
Dnah3 A T 7: 120,047,596 I1070K probably benign Het
Dnm2 G A 9: 21,472,624 V234M probably damaging Het
Drg2 T A 11: 60,459,461 M82K probably benign Het
Dus2 G A 8: 106,050,318 E312K probably benign Het
Efcab6 T C 15: 83,872,419 E1240G possibly damaging Het
Ep400 T C 5: 110,685,485 E1957G unknown Het
Gpnmb A G 6: 49,051,984 S479G probably damaging Het
Gpr153 T C 4: 152,283,059 S456P probably benign Het
Gprc5b A T 7: 118,976,538 M388K probably damaging Het
H2-T23 T C 17: 36,032,335 D50G possibly damaging Het
Hipk1 T C 3: 103,777,567 E244G probably damaging Het
Malrd1 T A 2: 15,695,201 C620S unknown Het
Maz G A 7: 127,024,911 Q358* probably null Het
Mcc A T 18: 44,442,918 I901N probably benign Het
Megf11 T G 9: 64,638,450 C172G probably damaging Het
Mipol1 A G 12: 57,306,034 Y53C probably benign Het
Nectin4 C T 1: 171,385,683 T391I probably damaging Het
Nell2 A T 15: 95,385,076 Y362N possibly damaging Het
Nphp4 T C 4: 152,544,461 probably null Het
Nsun4 A G 4: 116,034,276 V302A probably benign Het
Odf2 T A 2: 29,901,237 L181H probably damaging Het
Olfr1076 T C 2: 86,508,510 I17T probably damaging Het
Opn1sw A G 6: 29,378,001 S328P possibly damaging Het
Pga5 C T 19: 10,669,533 G303S probably damaging Het
Pik3c2g T A 6: 139,882,016 Y712* probably null Het
Pkd1 C T 17: 24,575,926 R2196C probably damaging Het
Pkd1l3 TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA 8: 109,623,969 probably benign Het
Plekhm2 A T 4: 141,632,301 M385K probably damaging Het
Pole T C 5: 110,291,026 V164A possibly damaging Het
Prr19 T A 7: 25,302,910 F11Y probably damaging Het
Prtg G T 9: 72,849,861 L355F probably benign Het
Raph1 C A 1: 60,525,670 M219I unknown Het
Rtkn2 A G 10: 68,003,264 D140G possibly damaging Het
Serpina5 T C 12: 104,103,872 S343P probably damaging Het
Slc1a1 A G 19: 28,911,725 K466R probably benign Het
Slc43a1 G A 2: 84,860,162 V518M probably damaging Het
Slc47a2 A G 11: 61,336,923 L125P probably damaging Het
Slc4a7 C A 14: 14,766,803 C585* probably null Het
Snx19 A G 9: 30,435,900 E713G probably damaging Het
Tiam1 C T 16: 89,858,673 V715M probably damaging Het
Tln2 T A 9: 67,370,761 M322L probably benign Het
Top2a G A 11: 99,011,058 R449* probably null Het
Trpv4 C A 5: 114,658,413 probably benign Het
Vmn1r214 A C 13: 23,034,925 R196S probably benign Het
Vmn1r43 A T 6: 89,869,570 H311Q possibly damaging Het
Vmn1r54 A G 6: 90,270,027 T308A probably benign Het
Zfand3 T A 17: 30,135,505 Y99N probably benign Het
Zfp345 G A 2: 150,472,583 H345Y possibly damaging Het
Zyg11a T C 4: 108,189,729 E516G probably damaging Het
Other mutations in Zfp119b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Zfp119b APN 17 55939270 missense probably damaging 1.00
IGL01868:Zfp119b APN 17 55939866 missense possibly damaging 0.70
IGL02623:Zfp119b APN 17 55939793 missense probably damaging 0.96
R0377:Zfp119b UTSW 17 55938671 missense probably damaging 1.00
R1833:Zfp119b UTSW 17 55939271 missense probably damaging 1.00
R2177:Zfp119b UTSW 17 55938639 missense probably damaging 1.00
R2297:Zfp119b UTSW 17 55939355 missense possibly damaging 0.46
R4273:Zfp119b UTSW 17 55938926 missense possibly damaging 0.79
R4801:Zfp119b UTSW 17 55939642 missense probably damaging 0.96
R4802:Zfp119b UTSW 17 55939642 missense probably damaging 0.96
R6525:Zfp119b UTSW 17 55939992 missense possibly damaging 0.96
R6644:Zfp119b UTSW 17 55939148 missense probably benign 0.21
R6950:Zfp119b UTSW 17 55939137 missense probably damaging 1.00
R6974:Zfp119b UTSW 17 55938564 missense probably benign 0.02
R7750:Zfp119b UTSW 17 55938682 missense probably damaging 1.00
R8882:Zfp119b UTSW 17 55939923 missense possibly damaging 0.84
R9431:Zfp119b UTSW 17 55939536 missense possibly damaging 0.78
RF020:Zfp119b UTSW 17 55939499 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCATTTCTTAGATTGCTGGGGAAT -3'
(R):5'- CAGCCACACCGAAGAACTCATTT -3'

Sequencing Primer
(F):5'- CCCACACTGATTGCATTTATAGGG -3'
(R):5'- CACACCGAAGAACTCATTTGGGAATG -3'
Posted On 2022-04-18