Incidental Mutation 'R9385:Plxna2'
ID 710235
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Name plexin A2
Synonyms 2810428A13Rik, OCT, PlexA2, Plxn2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 194618218-194816869 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 194749416 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 571 (V571A)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
AlphaFold P70207
PDB Structure Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027952
AA Change: V571A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: V571A

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,161,192 I554T possibly damaging Het
4930435E12Rik T G 16: 38,828,045 D234A probably benign Het
Adamts7 C A 9: 90,195,205 C1308* probably null Het
Ank2 A G 3: 126,959,717 V305A probably benign Het
Apob A G 12: 8,006,399 N1627S possibly damaging Het
Atp10a A T 7: 58,828,139 Q1310L probably benign Het
Atp8b4 A T 2: 126,480,631 Y29* probably null Het
Card11 C A 5: 140,885,521 R742S probably benign Het
Ccdc88a A G 11: 29,455,422 D365G probably benign Het
Ccdc88b G A 19: 6,856,165 R211W probably benign Het
Cda T G 4: 138,351,287 I55L probably benign Het
Cdkl3 A C 11: 52,035,952 E577D probably benign Het
Cel T C 2: 28,560,575 D146G probably damaging Het
Cmya5 A G 13: 93,094,372 S1403P probably damaging Het
Cntn2 G A 1: 132,528,174 S202L probably damaging Het
Col15a1 C T 4: 47,300,473 Q1045* probably null Het
Csmd1 T C 8: 15,984,756 T2472A probably benign Het
Ctbp2 G A 7: 132,999,340 R22C probably benign Het
Ddit4 A G 10: 59,951,356 S53P probably damaging Het
Ddx52 G T 11: 83,952,270 C365F probably damaging Het
Dnhd1 C A 7: 105,712,765 L3677I probably damaging Het
Dscam T C 16: 97,039,003 T135A probably benign Het
Espl1 T A 15: 102,298,750 D216E probably damaging Het
Fsip2 T A 2: 82,989,449 D5175E possibly damaging Het
Fxr1 A G 3: 34,019,971 probably benign Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gm3264 T C 14: 4,871,178 I8T possibly damaging Het
Gm35339 A G 15: 76,356,167 T352A Het
Gsdmc A T 15: 63,803,637 Y110N possibly damaging Het
H13 A G 2: 152,695,493 N286S probably benign Het
Heatr1 A G 13: 12,406,542 D441G probably damaging Het
Hist1h2aa A T 13: 23,934,696 I79F probably damaging Het
Hps6 A G 19: 46,005,910 D762G probably damaging Het
Hyou1 C A 9: 44,381,515 Q141K probably benign Het
Lpin3 T C 2: 160,897,073 I267T probably benign Het
Mdc1 A G 17: 35,850,504 K770E probably benign Het
Mlh3 C T 12: 85,269,370 R14H probably damaging Het
Nfxl1 C A 5: 72,537,407 V478F probably benign Het
Nhlrc3 A G 3: 53,453,594 W247R probably damaging Het
Nlrc3 C T 16: 3,964,012 G527D probably damaging Het
Nop9 A G 14: 55,751,127 E342G probably benign Het
Ntn1 C A 11: 68,385,187 G312C probably damaging Het
Olfr288 C T 15: 98,187,605 S64N probably damaging Het
Olfr474 T A 7: 107,955,573 *311K probably null Het
Opcml T C 9: 28,675,163 V59A possibly damaging Het
Opn1sw T G 6: 29,379,426 Y193S probably damaging Het
Pabpc4l A T 3: 46,446,702 V169E probably damaging Het
Pde3a A G 6: 141,492,256 D1017G probably benign Het
Plagl2 C T 2: 153,232,318 C221Y probably damaging Het
Plppr4 G T 3: 117,322,728 N493K possibly damaging Het
Pnma2 A G 14: 66,915,922 probably benign Het
Rnf123 T A 9: 108,052,268 E1234D probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc22a23 T C 13: 34,344,578 S74G probably benign Het
Slc36a4 T C 9: 15,734,267 I330T probably damaging Het
Snrk A T 9: 122,166,397 D414V probably benign Het
Snrnp200 G A 2: 127,238,058 probably null Het
Spata31d1b T C 13: 59,715,589 S184P probably damaging Het
Tas2r140 A T 6: 133,055,278 N172K probably benign Het
Tbc1d4 G T 14: 101,462,920 Q858K probably damaging Het
Tial1 A G 7: 128,442,485 C102R unknown Het
Ugt8a A T 3: 125,871,614 D411E probably benign Het
Usp34 A G 11: 23,449,223 D2404G Het
Vmn1r10 A C 6: 57,113,848 I142L probably benign Het
Wdr66 T C 5: 123,288,815 L919S probably damaging Het
Xpo7 A T 14: 70,688,293 D435E probably damaging Het
Zmym1 A G 4: 127,058,890 S33P probably damaging Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194644657 missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194789830 missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194800568 missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194644096 missense probably benign 0.03
IGL00704:Plxna2 APN 1 194751461 missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194746239 splice site probably benign
IGL01078:Plxna2 APN 1 194786693 unclassified probably benign
IGL01354:Plxna2 APN 1 194762435 missense probably benign 0.02
IGL01432:Plxna2 APN 1 194644318 missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194764570 missense probably benign 0.00
IGL01525:Plxna2 APN 1 194712311 missense probably benign 0.00
IGL01656:Plxna2 APN 1 194790161 missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194788902 missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194643950 missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194751488 missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194799776 missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194794383 missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194644424 missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194752089 missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194643964 missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194746150 missense probably benign 0.10
IGL02545:Plxna2 APN 1 194786690 unclassified probably benign
IGL02553:Plxna2 APN 1 194751438 missense probably benign 0.08
IGL02882:Plxna2 APN 1 194762570 missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194749309 splice site probably benign
IGL03062:Plxna2 APN 1 194762550 missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194801127 missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194804945 missense probably damaging 0.99
G1Funyon:Plxna2 UTSW 1 194790175 missense probably benign 0.01
PIT4514001:Plxna2 UTSW 1 194794937 missense probably benign 0.00
R0024:Plxna2 UTSW 1 194643995 missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0217:Plxna2 UTSW 1 194644598 missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194644150 missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194644404 nonsense probably null
R0505:Plxna2 UTSW 1 194644348 missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194751386 missense probably benign 0.00
R0669:Plxna2 UTSW 1 194788837 missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194649475 missense probably benign 0.00
R0885:Plxna2 UTSW 1 194644556 missense probably benign
R0898:Plxna2 UTSW 1 194797024 missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194800555 missense probably benign 0.01
R1061:Plxna2 UTSW 1 194644093 missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194780510 splice site probably null
R1222:Plxna2 UTSW 1 194800649 missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194644486 missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194804939 nonsense probably null
R1432:Plxna2 UTSW 1 194767463 missense probably benign 0.10
R1434:Plxna2 UTSW 1 194751540 splice site probably benign
R1597:Plxna2 UTSW 1 194749306 splice site probably benign
R1719:Plxna2 UTSW 1 194644370 missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194810970 missense probably benign 0.01
R1795:Plxna2 UTSW 1 194806303 missense probably damaging 0.99
R1819:Plxna2 UTSW 1 194790186 missense probably benign 0.03
R1926:Plxna2 UTSW 1 194762450 missense probably benign 0.02
R1966:Plxna2 UTSW 1 194644700 missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R2034:Plxna2 UTSW 1 194780594 missense probably benign 0.00
R2131:Plxna2 UTSW 1 194644750 missense probably benign 0.01
R2171:Plxna2 UTSW 1 194800617 missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194797748 missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194797731 missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194788885 missense probably benign 0.42
R3783:Plxna2 UTSW 1 194807521 missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194644617 missense probably benign
R3787:Plxna2 UTSW 1 194643934 missense probably benign 0.10
R3845:Plxna2 UTSW 1 194793790 missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194746157 missense probably benign 0.02
R3930:Plxna2 UTSW 1 194794910 missense probably benign 0.17
R3964:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3980:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194780627 missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194644454 missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194644775 missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194810988 missense possibly damaging 0.91
R4622:Plxna2 UTSW 1 194812150 missense probably benign
R4623:Plxna2 UTSW 1 194812150 missense probably benign
R4684:Plxna2 UTSW 1 194762594 missense probably benign 0.42
R4688:Plxna2 UTSW 1 194644445 missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194797732 missense probably benign 0.39
R4876:Plxna2 UTSW 1 194643775 missense probably benign 0.02
R5161:Plxna2 UTSW 1 194751404 missense probably benign
R5207:Plxna2 UTSW 1 194788899 missense probably benign 0.19
R5479:Plxna2 UTSW 1 194793873 missense probably benign
R5931:Plxna2 UTSW 1 194810870 missense probably damaging 1.00
R6026:Plxna2 UTSW 1 194799814 missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194794427 missense probably benign 0.00
R6029:Plxna2 UTSW 1 194799575 missense probably damaging 1.00
R6059:Plxna2 UTSW 1 194810971 missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194790196 missense probably benign 0.01
R6322:Plxna2 UTSW 1 194754367 missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194810088 missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194789766 missense probably benign 0.01
R6748:Plxna2 UTSW 1 194794182 splice site probably null
R6838:Plxna2 UTSW 1 194804914 missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194793828 missense probably benign 0.08
R7069:Plxna2 UTSW 1 194793904 missense possibly damaging 0.51
R7122:Plxna2 UTSW 1 194644568 nonsense probably null
R7145:Plxna2 UTSW 1 194649522 missense probably benign 0.31
R7189:Plxna2 UTSW 1 194801058 missense possibly damaging 0.58
R7207:Plxna2 UTSW 1 194644019 missense probably damaging 1.00
R7232:Plxna2 UTSW 1 194712260 missense probably damaging 1.00
R7234:Plxna2 UTSW 1 194806390 missense probably damaging 0.96
R7246:Plxna2 UTSW 1 194644282 missense possibly damaging 0.74
R7255:Plxna2 UTSW 1 194752103 missense probably benign 0.03
R7283:Plxna2 UTSW 1 194644883 missense probably damaging 0.99
R7288:Plxna2 UTSW 1 194796919 missense probably damaging 1.00
R7361:Plxna2 UTSW 1 194799779 missense probably damaging 1.00
R7424:Plxna2 UTSW 1 194806339 missense probably damaging 0.98
R7501:Plxna2 UTSW 1 194643895 missense possibly damaging 0.95
R7528:Plxna2 UTSW 1 194812156 missense probably damaging 1.00
R7529:Plxna2 UTSW 1 194643871 missense probably benign 0.25
R7532:Plxna2 UTSW 1 194644819 missense probably benign 0.13
R7959:Plxna2 UTSW 1 194793864 frame shift probably null
R7959:Plxna2 UTSW 1 194810962 missense probably damaging 1.00
R7960:Plxna2 UTSW 1 194793864 frame shift probably null
R8261:Plxna2 UTSW 1 194749416 missense probably damaging 1.00
R8301:Plxna2 UTSW 1 194790175 missense probably benign 0.01
R8463:Plxna2 UTSW 1 194644046 missense probably damaging 1.00
R8519:Plxna2 UTSW 1 194793958 missense probably damaging 1.00
R8836:Plxna2 UTSW 1 194796935 missense possibly damaging 0.94
R9010:Plxna2 UTSW 1 194788909 missense possibly damaging 0.95
R9034:Plxna2 UTSW 1 194793889 missense probably damaging 1.00
R9254:Plxna2 UTSW 1 194810166 missense probably damaging 1.00
R9274:Plxna2 UTSW 1 194788828 missense probably damaging 1.00
R9379:Plxna2 UTSW 1 194810166 missense probably damaging 1.00
R9422:Plxna2 UTSW 1 194644422 missense probably damaging 1.00
R9451:Plxna2 UTSW 1 194644384 missense probably benign 0.05
R9484:Plxna2 UTSW 1 194644894 missense probably damaging 1.00
X0027:Plxna2 UTSW 1 194644433 missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194644441 missense possibly damaging 0.56
Z1088:Plxna2 UTSW 1 194764539 missense probably benign 0.06
Predicted Primers
Posted On 2022-04-18