Incidental Mutation 'R9385:Snrnp200'
ID 710239
Institutional Source Beutler Lab
Gene Symbol Snrnp200
Ensembl Gene ENSMUSG00000003660
Gene Name small nuclear ribonucleoprotein 200 (U5)
Synonyms HELIC2, U5-200KD, A330064G03Rik, Ascc3l1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 127208386-127240451 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) G to A at 127238058 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003759] [ENSMUST00000103220] [ENSMUST00000174030] [ENSMUST00000174863]
AlphaFold Q6P4T2
Predicted Effect probably benign
Transcript: ENSMUST00000003759
SMART Domains Protein: ENSMUSP00000003759
Gene: ENSMUSG00000003662

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 178 6.04e-8 SMART
WD40 183 222 9.22e-13 SMART
WD40 240 280 8.04e-4 SMART
WD40 291 332 5.26e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103220
SMART Domains Protein: ENSMUSP00000099509
Gene: ENSMUSG00000003660

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 206 223 N/A INTRINSIC
low complexity region 373 386 N/A INTRINSIC
DEXDc 477 690 2.63e-30 SMART
AAA 495 680 5.77e-2 SMART
HELICc 768 860 3.76e-17 SMART
low complexity region 876 887 N/A INTRINSIC
Sec63 981 1286 2.62e-128 SMART
DEXDc 1324 1528 1.43e-31 SMART
AAA 1342 1533 2.39e0 SMART
HELICc 1607 1695 1.26e-9 SMART
Sec63 1812 2124 1.39e-118 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174030
SMART Domains Protein: ENSMUSP00000134189
Gene: ENSMUSG00000003662

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 178 6.04e-8 SMART
WD40 183 222 9.22e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174863
SMART Domains Protein: ENSMUSP00000134159
Gene: ENSMUSG00000003662

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 176 1.38e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: On February 19, 2002, this locus was switched from human to mouse. The source accession, Z70200.1, is almost identical to the mouse BAC clone AC074224, and it matches the mouse cDNA accession BC011390 as well. The human gene is LocusID 23020. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,161,192 I554T possibly damaging Het
4930435E12Rik T G 16: 38,828,045 D234A probably benign Het
Adamts7 C A 9: 90,195,205 C1308* probably null Het
Ank2 A G 3: 126,959,717 V305A probably benign Het
Apob A G 12: 8,006,399 N1627S possibly damaging Het
Atp10a A T 7: 58,828,139 Q1310L probably benign Het
Atp8b4 A T 2: 126,480,631 Y29* probably null Het
Card11 C A 5: 140,885,521 R742S probably benign Het
Ccdc88a A G 11: 29,455,422 D365G probably benign Het
Ccdc88b G A 19: 6,856,165 R211W probably benign Het
Cda T G 4: 138,351,287 I55L probably benign Het
Cdkl3 A C 11: 52,035,952 E577D probably benign Het
Cel T C 2: 28,560,575 D146G probably damaging Het
Cmya5 A G 13: 93,094,372 S1403P probably damaging Het
Cntn2 G A 1: 132,528,174 S202L probably damaging Het
Col15a1 C T 4: 47,300,473 Q1045* probably null Het
Csmd1 T C 8: 15,984,756 T2472A probably benign Het
Ctbp2 G A 7: 132,999,340 R22C probably benign Het
Ddit4 A G 10: 59,951,356 S53P probably damaging Het
Ddx52 G T 11: 83,952,270 C365F probably damaging Het
Dnhd1 C A 7: 105,712,765 L3677I probably damaging Het
Dscam T C 16: 97,039,003 T135A probably benign Het
Espl1 T A 15: 102,298,750 D216E probably damaging Het
Fsip2 T A 2: 82,989,449 D5175E possibly damaging Het
Fxr1 A G 3: 34,019,971 probably benign Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gm3264 T C 14: 4,871,178 I8T possibly damaging Het
Gm35339 A G 15: 76,356,167 T352A Het
Gsdmc A T 15: 63,803,637 Y110N possibly damaging Het
H13 A G 2: 152,695,493 N286S probably benign Het
Heatr1 A G 13: 12,406,542 D441G probably damaging Het
Hist1h2aa A T 13: 23,934,696 I79F probably damaging Het
Hps6 A G 19: 46,005,910 D762G probably damaging Het
Hyou1 C A 9: 44,381,515 Q141K probably benign Het
Lpin3 T C 2: 160,897,073 I267T probably benign Het
Mdc1 A G 17: 35,850,504 K770E probably benign Het
Mlh3 C T 12: 85,269,370 R14H probably damaging Het
Nfxl1 C A 5: 72,537,407 V478F probably benign Het
Nhlrc3 A G 3: 53,453,594 W247R probably damaging Het
Nlrc3 C T 16: 3,964,012 G527D probably damaging Het
Nop9 A G 14: 55,751,127 E342G probably benign Het
Ntn1 C A 11: 68,385,187 G312C probably damaging Het
Olfr288 C T 15: 98,187,605 S64N probably damaging Het
Olfr474 T A 7: 107,955,573 *311K probably null Het
Opcml T C 9: 28,675,163 V59A possibly damaging Het
Opn1sw T G 6: 29,379,426 Y193S probably damaging Het
Pabpc4l A T 3: 46,446,702 V169E probably damaging Het
Pde3a A G 6: 141,492,256 D1017G probably benign Het
Plagl2 C T 2: 153,232,318 C221Y probably damaging Het
Plppr4 G T 3: 117,322,728 N493K possibly damaging Het
Plxna2 T C 1: 194,749,416 V571A possibly damaging Het
Pnma2 A G 14: 66,915,922 probably benign Het
Rnf123 T A 9: 108,052,268 E1234D probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc22a23 T C 13: 34,344,578 S74G probably benign Het
Slc36a4 T C 9: 15,734,267 I330T probably damaging Het
Snrk A T 9: 122,166,397 D414V probably benign Het
Spata31d1b T C 13: 59,715,589 S184P probably damaging Het
Tas2r140 A T 6: 133,055,278 N172K probably benign Het
Tbc1d4 G T 14: 101,462,920 Q858K probably damaging Het
Tial1 A G 7: 128,442,485 C102R unknown Het
Ugt8a A T 3: 125,871,614 D411E probably benign Het
Usp34 A G 11: 23,449,223 D2404G Het
Vmn1r10 A C 6: 57,113,848 I142L probably benign Het
Wdr66 T C 5: 123,288,815 L919S probably damaging Het
Xpo7 A T 14: 70,688,293 D435E probably damaging Het
Zmym1 A G 4: 127,058,890 S33P probably damaging Het
Other mutations in Snrnp200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Snrnp200 APN 2 127230135 missense possibly damaging 0.80
IGL01013:Snrnp200 APN 2 127232472 missense probably damaging 1.00
IGL01073:Snrnp200 APN 2 127214912 splice site probably benign
IGL01319:Snrnp200 APN 2 127230127 splice site probably benign
IGL01597:Snrnp200 APN 2 127238732 unclassified probably benign
IGL01631:Snrnp200 APN 2 127238824 unclassified probably benign
IGL01646:Snrnp200 APN 2 127222228 missense probably benign 0.00
IGL02019:Snrnp200 APN 2 127232905 missense possibly damaging 0.94
IGL02158:Snrnp200 APN 2 127237483 missense probably benign 0.05
IGL02269:Snrnp200 APN 2 127229991 missense possibly damaging 0.67
IGL02288:Snrnp200 APN 2 127229895 missense probably damaging 1.00
IGL02437:Snrnp200 APN 2 127216110 missense probably damaging 1.00
IGL02476:Snrnp200 APN 2 127217488 missense probably benign 0.41
IGL02613:Snrnp200 APN 2 127218426 missense probably damaging 0.98
IGL02898:Snrnp200 APN 2 127216756 splice site probably benign
IGL03108:Snrnp200 APN 2 127238167 missense possibly damaging 0.82
IGL03143:Snrnp200 APN 2 127230042 critical splice donor site probably benign
IGL03237:Snrnp200 APN 2 127233313 missense probably damaging 0.99
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0057:Snrnp200 UTSW 2 127237907 missense probably damaging 0.96
R0270:Snrnp200 UTSW 2 127232982 missense probably damaging 0.97
R0626:Snrnp200 UTSW 2 127221814 missense possibly damaging 0.46
R0731:Snrnp200 UTSW 2 127226145 splice site probably benign
R1175:Snrnp200 UTSW 2 127229077 missense probably damaging 1.00
R1184:Snrnp200 UTSW 2 127236817 missense probably damaging 1.00
R1383:Snrnp200 UTSW 2 127218411 missense probably benign 0.10
R1444:Snrnp200 UTSW 2 127228238 splice site probably benign
R1757:Snrnp200 UTSW 2 127232443 missense probably damaging 1.00
R1794:Snrnp200 UTSW 2 127216736 missense probably benign
R1808:Snrnp200 UTSW 2 127219027 critical splice acceptor site probably null
R1808:Snrnp200 UTSW 2 127219028 critical splice acceptor site probably null
R1957:Snrnp200 UTSW 2 127216175 missense possibly damaging 0.69
R2007:Snrnp200 UTSW 2 127227048 missense probably damaging 1.00
R2039:Snrnp200 UTSW 2 127234984 missense probably benign 0.19
R2070:Snrnp200 UTSW 2 127212403 missense possibly damaging 0.89
R2070:Snrnp200 UTSW 2 127237883 missense probably benign 0.00
R2892:Snrnp200 UTSW 2 127231777 missense probably damaging 0.99
R3236:Snrnp200 UTSW 2 127221882 missense probably damaging 1.00
R3862:Snrnp200 UTSW 2 127233099 splice site probably benign
R4028:Snrnp200 UTSW 2 127237566 missense probably damaging 0.99
R4105:Snrnp200 UTSW 2 127228016 missense probably damaging 1.00
R4328:Snrnp200 UTSW 2 127222217 missense probably damaging 0.99
R4471:Snrnp200 UTSW 2 127238753 missense probably benign 0.03
R4526:Snrnp200 UTSW 2 127229102 missense probably benign
R4575:Snrnp200 UTSW 2 127235066 missense probably benign 0.00
R4710:Snrnp200 UTSW 2 127226133 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127217414 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127227878 missense possibly damaging 0.89
R4729:Snrnp200 UTSW 2 127232937 missense probably damaging 0.99
R4828:Snrnp200 UTSW 2 127211607 missense probably damaging 0.99
R5082:Snrnp200 UTSW 2 127226370 nonsense probably null
R5213:Snrnp200 UTSW 2 127231741 missense probably damaging 1.00
R5287:Snrnp200 UTSW 2 127231687 missense probably benign 0.13
R5486:Snrnp200 UTSW 2 127233066 missense possibly damaging 0.82
R5595:Snrnp200 UTSW 2 127226013 missense probably damaging 0.99
R5598:Snrnp200 UTSW 2 127226087 missense possibly damaging 0.64
R5681:Snrnp200 UTSW 2 127225135 missense probably damaging 1.00
R6207:Snrnp200 UTSW 2 127210735 missense probably benign 0.00
R6258:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6259:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6299:Snrnp200 UTSW 2 127222161 nonsense probably null
R6434:Snrnp200 UTSW 2 127238654 missense probably damaging 1.00
R6522:Snrnp200 UTSW 2 127221827 missense probably benign 0.12
R6647:Snrnp200 UTSW 2 127226452 missense probably damaging 1.00
R6785:Snrnp200 UTSW 2 127229165 missense possibly damaging 0.70
R7027:Snrnp200 UTSW 2 127217272 missense probably benign 0.09
R7358:Snrnp200 UTSW 2 127221826 missense probably benign 0.03
R7436:Snrnp200 UTSW 2 127226484 critical splice donor site probably null
R7587:Snrnp200 UTSW 2 127227902 missense probably damaging 1.00
R7672:Snrnp200 UTSW 2 127221902 missense probably damaging 1.00
R7731:Snrnp200 UTSW 2 127229102 missense probably benign
R7841:Snrnp200 UTSW 2 127236834 missense probably benign 0.23
R7863:Snrnp200 UTSW 2 127231689 missense probably damaging 1.00
R7916:Snrnp200 UTSW 2 127233059 missense possibly damaging 0.51
R8117:Snrnp200 UTSW 2 127229131 missense probably benign
R8262:Snrnp200 UTSW 2 127227008 missense probably damaging 1.00
R8551:Snrnp200 UTSW 2 127227051 missense probably benign 0.03
R8675:Snrnp200 UTSW 2 127232523 missense possibly damaging 0.94
R8754:Snrnp200 UTSW 2 127226085 missense probably damaging 1.00
R8852:Snrnp200 UTSW 2 127218429 missense probably damaging 0.99
R8899:Snrnp200 UTSW 2 127236597 missense probably damaging 1.00
R8937:Snrnp200 UTSW 2 127226982 missense probably benign 0.04
R9030:Snrnp200 UTSW 2 127211546 intron probably benign
R9260:Snrnp200 UTSW 2 127236508 missense probably damaging 1.00
R9366:Snrnp200 UTSW 2 127216090 missense probably benign 0.01
R9478:Snrnp200 UTSW 2 127235073 critical splice donor site probably null
R9652:Snrnp200 UTSW 2 127226039 missense probably damaging 1.00
R9653:Snrnp200 UTSW 2 127226039 missense probably damaging 1.00
R9733:Snrnp200 UTSW 2 127226320 missense probably damaging 1.00
RF016:Snrnp200 UTSW 2 127230556 missense probably damaging 1.00
Z1176:Snrnp200 UTSW 2 127234975 missense probably benign 0.10
Z1177:Snrnp200 UTSW 2 127236031 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CATGTGAAGACCAATCTGCTG -3'
(R):5'- GCAATGTTCTGAAGCGCATC -3'

Sequencing Primer
(F):5'- TGCTGCTGCAGGCTCAC -3'
(R):5'- GTTCTGAAGCGCATCACCCAG -3'
Posted On 2022-04-18