Incidental Mutation 'R9385:Pabpc4l'
ID 710244
Institutional Source Beutler Lab
Gene Symbol Pabpc4l
Ensembl Gene ENSMUSG00000090919
Gene Name poly(A) binding protein, cytoplasmic 4-like
Synonyms EG241989, C330050A14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 46442197-46448219 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46446702 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 169 (V169E)
Ref Sequence ENSEMBL: ENSMUSP00000126224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166505] [ENSMUST00000192793] [ENSMUST00000195436] [ENSMUST00000195537]
AlphaFold G5E8X2
Predicted Effect probably damaging
Transcript: ENSMUST00000166505
AA Change: V169E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126224
Gene: ENSMUSG00000090919
AA Change: V169E

DomainStartEndE-ValueType
RRM 11 84 3.4e-17 SMART
RRM 99 170 4.22e-22 SMART
RRM 191 263 2.44e-27 SMART
RRM 294 365 7.24e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192793
AA Change: V169E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141300
Gene: ENSMUSG00000090919
AA Change: V169E

DomainStartEndE-ValueType
RRM 11 84 3.4e-17 SMART
RRM 99 170 4.22e-22 SMART
RRM 191 263 2.44e-27 SMART
RRM 294 365 7.24e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195436
AA Change: V169E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141684
Gene: ENSMUSG00000090919
AA Change: V169E

DomainStartEndE-ValueType
RRM 11 84 1.5e-19 SMART
RRM 99 170 1.8e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195537
SMART Domains Protein: ENSMUSP00000141854
Gene: ENSMUSG00000090919

DomainStartEndE-ValueType
Pfam:RRM_1 12 51 8.9e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,161,192 I554T possibly damaging Het
4930435E12Rik T G 16: 38,828,045 D234A probably benign Het
Adamts7 C A 9: 90,195,205 C1308* probably null Het
Ank2 A G 3: 126,959,717 V305A probably benign Het
Apob A G 12: 8,006,399 N1627S possibly damaging Het
Atp10a A T 7: 58,828,139 Q1310L probably benign Het
Atp8b4 A T 2: 126,480,631 Y29* probably null Het
Card11 C A 5: 140,885,521 R742S probably benign Het
Ccdc88a A G 11: 29,455,422 D365G probably benign Het
Ccdc88b G A 19: 6,856,165 R211W probably benign Het
Cda T G 4: 138,351,287 I55L probably benign Het
Cdkl3 A C 11: 52,035,952 E577D probably benign Het
Cel T C 2: 28,560,575 D146G probably damaging Het
Cmya5 A G 13: 93,094,372 S1403P probably damaging Het
Cntn2 G A 1: 132,528,174 S202L probably damaging Het
Col15a1 C T 4: 47,300,473 Q1045* probably null Het
Csmd1 T C 8: 15,984,756 T2472A probably benign Het
Ctbp2 G A 7: 132,999,340 R22C probably benign Het
Ddit4 A G 10: 59,951,356 S53P probably damaging Het
Ddx52 G T 11: 83,952,270 C365F probably damaging Het
Dnhd1 C A 7: 105,712,765 L3677I probably damaging Het
Dscam T C 16: 97,039,003 T135A probably benign Het
Espl1 T A 15: 102,298,750 D216E probably damaging Het
Fsip2 T A 2: 82,989,449 D5175E possibly damaging Het
Fxr1 A G 3: 34,019,971 probably benign Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gm3264 T C 14: 4,871,178 I8T possibly damaging Het
Gm35339 A G 15: 76,356,167 T352A Het
Gsdmc A T 15: 63,803,637 Y110N possibly damaging Het
H13 A G 2: 152,695,493 N286S probably benign Het
Heatr1 A G 13: 12,406,542 D441G probably damaging Het
Hist1h2aa A T 13: 23,934,696 I79F probably damaging Het
Hps6 A G 19: 46,005,910 D762G probably damaging Het
Hyou1 C A 9: 44,381,515 Q141K probably benign Het
Lpin3 T C 2: 160,897,073 I267T probably benign Het
Mdc1 A G 17: 35,850,504 K770E probably benign Het
Mlh3 C T 12: 85,269,370 R14H probably damaging Het
Nfxl1 C A 5: 72,537,407 V478F probably benign Het
Nhlrc3 A G 3: 53,453,594 W247R probably damaging Het
Nlrc3 C T 16: 3,964,012 G527D probably damaging Het
Nop9 A G 14: 55,751,127 E342G probably benign Het
Ntn1 C A 11: 68,385,187 G312C probably damaging Het
Olfr288 C T 15: 98,187,605 S64N probably damaging Het
Olfr474 T A 7: 107,955,573 *311K probably null Het
Opcml T C 9: 28,675,163 V59A possibly damaging Het
Opn1sw T G 6: 29,379,426 Y193S probably damaging Het
Pde3a A G 6: 141,492,256 D1017G probably benign Het
Plagl2 C T 2: 153,232,318 C221Y probably damaging Het
Plppr4 G T 3: 117,322,728 N493K possibly damaging Het
Plxna2 T C 1: 194,749,416 V571A possibly damaging Het
Pnma2 A G 14: 66,915,922 probably benign Het
Rnf123 T A 9: 108,052,268 E1234D probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc22a23 T C 13: 34,344,578 S74G probably benign Het
Slc36a4 T C 9: 15,734,267 I330T probably damaging Het
Snrk A T 9: 122,166,397 D414V probably benign Het
Snrnp200 G A 2: 127,238,058 probably null Het
Spata31d1b T C 13: 59,715,589 S184P probably damaging Het
Tas2r140 A T 6: 133,055,278 N172K probably benign Het
Tbc1d4 G T 14: 101,462,920 Q858K probably damaging Het
Tial1 A G 7: 128,442,485 C102R unknown Het
Ugt8a A T 3: 125,871,614 D411E probably benign Het
Usp34 A G 11: 23,449,223 D2404G Het
Vmn1r10 A C 6: 57,113,848 I142L probably benign Het
Wdr66 T C 5: 123,288,815 L919S probably damaging Het
Xpo7 A T 14: 70,688,293 D435E probably damaging Het
Zmym1 A G 4: 127,058,890 S33P probably damaging Het
Other mutations in Pabpc4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Pabpc4l APN 3 46447072 missense possibly damaging 0.80
IGL01594:Pabpc4l APN 3 46447146 missense probably damaging 1.00
IGL01727:Pabpc4l APN 3 46446665 missense probably damaging 1.00
IGL02937:Pabpc4l APN 3 46446290 missense probably benign 0.04
IGL02985:Pabpc4l APN 3 46446582 missense possibly damaging 0.52
IGL03393:Pabpc4l APN 3 46446537 missense probably damaging 0.98
R0734:Pabpc4l UTSW 3 46446973 missense possibly damaging 0.71
R1889:Pabpc4l UTSW 3 46446363 missense probably benign 0.00
R1928:Pabpc4l UTSW 3 46446631 missense probably damaging 1.00
R2118:Pabpc4l UTSW 3 46446841 missense probably benign 0.00
R2119:Pabpc4l UTSW 3 46446841 missense probably benign 0.00
R2124:Pabpc4l UTSW 3 46446841 missense probably benign 0.00
R2238:Pabpc4l UTSW 3 46446702 missense probably damaging 1.00
R4740:Pabpc4l UTSW 3 46446135 missense possibly damaging 0.95
R4740:Pabpc4l UTSW 3 46446144 missense probably benign 0.03
R4897:Pabpc4l UTSW 3 46447143 missense probably damaging 1.00
R4911:Pabpc4l UTSW 3 46446162 missense possibly damaging 0.88
R5310:Pabpc4l UTSW 3 46446841 missense probably benign 0.00
R5532:Pabpc4l UTSW 3 46446609 missense probably benign 0.01
R5734:Pabpc4l UTSW 3 46446689 splice site probably null
R6200:Pabpc4l UTSW 3 46446703 missense probably damaging 1.00
R6994:Pabpc4l UTSW 3 46446910 missense possibly damaging 0.95
R7401:Pabpc4l UTSW 3 46446252 missense probably damaging 1.00
R7401:Pabpc4l UTSW 3 46446589 missense probably damaging 0.98
R7554:Pabpc4l UTSW 3 46447114 missense probably benign 0.30
R8321:Pabpc4l UTSW 3 46446294 missense probably damaging 1.00
R8506:Pabpc4l UTSW 3 46446397 nonsense probably null
R8998:Pabpc4l UTSW 3 46446348 missense probably benign 0.01
R8999:Pabpc4l UTSW 3 46446348 missense probably benign 0.01
R9320:Pabpc4l UTSW 3 46446891 missense probably damaging 0.99
R9669:Pabpc4l UTSW 3 46446832 missense probably damaging 1.00
R9737:Pabpc4l UTSW 3 46446832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGCATCTTTCATCACCTTAAC -3'
(R):5'- ATGCTTGCCTGAGGAGATCG -3'

Sequencing Primer
(F):5'- CACTCAAAGTTTGGCCATATTTGCTG -3'
(R):5'- GTCGGGAATGTGTTTATCAAGAATC -3'
Posted On 2022-04-18