Mutagenetix > Incidental Mutation

Incidental Mutation 'R9385:Plppr4'

710246

Institutional Source

Beutler Lab

Gene Symbol

Plppr4

Ensembl Gene

ENSMUSG00000044667

Gene Name

phospholipid phosphatase related 4

Synonyms

Lppr4, D3Bwg0562e

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9385 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

117319139-117360876 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 117322728 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 493 (N493K)

Ref Sequence

ENSEMBL: ENSMUSP00000052306 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061071] [ENSMUST00000197743]

AlphaFold

Q7TME0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061071
AA Change: N493K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000052306
Gene: ENSMUSG00000044667
AA Change: N493K

Domain	Start	End	E-Value	Type
acidPPc	180	324	4.07e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000197743
AA Change: N435K

PolyPhen 2 Score 0.706 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000143753
Gene: ENSMUSG00000044667
AA Change: N435K

Domain	Start	End	E-Value	Type
SCOP:d1d2ta_	59	268	1e-7	SMART
Blast:acidPPc	180	265	8e-53	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the lipid phosphate phosphatase (LPP) family. LPPs catalyze the dephosphorylation of a number of bioactive lipid mediators that regulate a variety of cell functions. This protein is specifically expressed in neurons. It is located in the membranes of outgrowing axons and has been shown to be important for axonal outgrowth during development and regenerative sprouting. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, seizures, hyperexcitability of evoked fEPSP, and premature lethality around 3 weeks of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,161,192	I554T	possibly damaging	Het
4930435E12Rik	T	G	16: 38,828,045	D234A	probably benign	Het
Adamts7	C	A	9: 90,195,205	C1308*	probably null	Het
Ank2	A	G	3: 126,959,717	V305A	probably benign	Het
Apob	A	G	12: 8,006,399	N1627S	possibly damaging	Het
Atp10a	A	T	7: 58,828,139	Q1310L	probably benign	Het
Atp8b4	A	T	2: 126,480,631	Y29*	probably null	Het
Card11	C	A	5: 140,885,521	R742S	probably benign	Het
Ccdc88a	A	G	11: 29,455,422	D365G	probably benign	Het
Ccdc88b	G	A	19: 6,856,165	R211W	probably benign	Het
Cda	T	G	4: 138,351,287	I55L	probably benign	Het
Cdkl3	A	C	11: 52,035,952	E577D	probably benign	Het
Cel	T	C	2: 28,560,575	D146G	probably damaging	Het
Cmya5	A	G	13: 93,094,372	S1403P	probably damaging	Het
Cntn2	G	A	1: 132,528,174	S202L	probably damaging	Het
Col15a1	C	T	4: 47,300,473	Q1045*	probably null	Het
Csmd1	T	C	8: 15,984,756	T2472A	probably benign	Het
Ctbp2	G	A	7: 132,999,340	R22C	probably benign	Het
Ddit4	A	G	10: 59,951,356	S53P	probably damaging	Het
Ddx52	G	T	11: 83,952,270	C365F	probably damaging	Het
Dnhd1	C	A	7: 105,712,765	L3677I	probably damaging	Het
Dscam	T	C	16: 97,039,003	T135A	probably benign	Het
Espl1	T	A	15: 102,298,750	D216E	probably damaging	Het
Fsip2	T	A	2: 82,989,449	D5175E	possibly damaging	Het
Fxr1	A	G	3: 34,019,971		probably benign	Het
Fyb	A	G	15: 6,634,816	D460G	probably benign	Het
Gm3264	T	C	14: 4,871,178	I8T	possibly damaging	Het
Gm35339	A	G	15: 76,356,167	T352A		Het
Gsdmc	A	T	15: 63,803,637	Y110N	possibly damaging	Het
H13	A	G	2: 152,695,493	N286S	probably benign	Het
Heatr1	A	G	13: 12,406,542	D441G	probably damaging	Het
Hist1h2aa	A	T	13: 23,934,696	I79F	probably damaging	Het
Hps6	A	G	19: 46,005,910	D762G	probably damaging	Het
Hyou1	C	A	9: 44,381,515	Q141K	probably benign	Het
Lpin3	T	C	2: 160,897,073	I267T	probably benign	Het
Mdc1	A	G	17: 35,850,504	K770E	probably benign	Het
Mlh3	C	T	12: 85,269,370	R14H	probably damaging	Het
Nfxl1	C	A	5: 72,537,407	V478F	probably benign	Het
Nhlrc3	A	G	3: 53,453,594	W247R	probably damaging	Het
Nlrc3	C	T	16: 3,964,012	G527D	probably damaging	Het
Nop9	A	G	14: 55,751,127	E342G	probably benign	Het
Ntn1	C	A	11: 68,385,187	G312C	probably damaging	Het
Olfr288	C	T	15: 98,187,605	S64N	probably damaging	Het
Olfr474	T	A	7: 107,955,573	*311K	probably null	Het
Opcml	T	C	9: 28,675,163	V59A	possibly damaging	Het
Opn1sw	T	G	6: 29,379,426	Y193S	probably damaging	Het
Pabpc4l	A	T	3: 46,446,702	V169E	probably damaging	Het
Pde3a	A	G	6: 141,492,256	D1017G	probably benign	Het
Plagl2	C	T	2: 153,232,318	C221Y	probably damaging	Het
Plxna2	T	C	1: 194,749,416	V571A	possibly damaging	Het
Pnma2	A	G	14: 66,915,922		probably benign	Het
Rnf123	T	A	9: 108,052,268	E1234D	probably benign	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Het
Slc22a23	T	C	13: 34,344,578	S74G	probably benign	Het
Slc36a4	T	C	9: 15,734,267	I330T	probably damaging	Het
Snrk	A	T	9: 122,166,397	D414V	probably benign	Het
Snrnp200	G	A	2: 127,238,058		probably null	Het
Spata31d1b	T	C	13: 59,715,589	S184P	probably damaging	Het
Tas2r140	A	T	6: 133,055,278	N172K	probably benign	Het
Tbc1d4	G	T	14: 101,462,920	Q858K	probably damaging	Het
Tial1	A	G	7: 128,442,485	C102R	unknown	Het
Ugt8a	A	T	3: 125,871,614	D411E	probably benign	Het
Usp34	A	G	11: 23,449,223	D2404G		Het
Vmn1r10	A	C	6: 57,113,848	I142L	probably benign	Het
Wdr66	T	C	5: 123,288,815	L919S	probably damaging	Het
Xpo7	A	T	14: 70,688,293	D435E	probably damaging	Het
Zmym1	A	G	4: 127,058,890	S33P	probably damaging	Het

Other mutations in Plppr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Plppr4	APN	3	117322220	missense	probably benign	0.01
IGL01969:Plppr4	APN	3	117328359	missense	probably damaging	1.00
IGL02014:Plppr4	APN	3	117335573	missense	probably damaging	1.00
IGL02068:Plppr4	APN	3	117331784	splice site	probably benign
IGL02426:Plppr4	APN	3	117322295	missense	probably benign	0.01
IGL03203:Plppr4	APN	3	117325891	missense	possibly damaging	0.89
PIT4445001:Plppr4	UTSW	3	117360308	unclassified	probably benign
R0376:Plppr4	UTSW	3	117323091	missense	probably benign	0.05
R0755:Plppr4	UTSW	3	117322670	missense	possibly damaging	0.68
R0831:Plppr4	UTSW	3	117331646	critical splice donor site	probably null
R1518:Plppr4	UTSW	3	117335503	missense	probably damaging	1.00
R1523:Plppr4	UTSW	3	117322841	missense	probably damaging	1.00
R1581:Plppr4	UTSW	3	117328266	missense	possibly damaging	0.58
R1628:Plppr4	UTSW	3	117328272	missense	probably damaging	1.00
R2510:Plppr4	UTSW	3	117331706	missense	probably damaging	0.99
R2511:Plppr4	UTSW	3	117331706	missense	probably damaging	0.99
R4332:Plppr4	UTSW	3	117322825	missense	probably benign
R4380:Plppr4	UTSW	3	117322397	missense	probably benign	0.40
R4787:Plppr4	UTSW	3	117322330	missense	probably damaging	0.99
R4829:Plppr4	UTSW	3	117335591	missense	possibly damaging	0.94
R5511:Plppr4	UTSW	3	117325902	missense	probably benign	0.39
R5819:Plppr4	UTSW	3	117325864	missense	possibly damaging	0.89
R6149:Plppr4	UTSW	3	117322394	missense	probably benign	0.22
R6257:Plppr4	UTSW	3	117322579	missense	possibly damaging	0.49
R6974:Plppr4	UTSW	3	117323018	missense	probably damaging	1.00
R7045:Plppr4	UTSW	3	117360034	missense	probably damaging	1.00
R7102:Plppr4	UTSW	3	117323183	missense	probably damaging	0.98
R7507:Plppr4	UTSW	3	117322105	missense	possibly damaging	0.76
R7820:Plppr4	UTSW	3	117321949	missense	possibly damaging	0.88
R8179:Plppr4	UTSW	3	117331678	missense	probably damaging	1.00
R8181:Plppr4	UTSW	3	117322465	missense	probably damaging	1.00
R8391:Plppr4	UTSW	3	117335411	missense	probably benign	0.02
R8531:Plppr4	UTSW	3	117321943	missense	probably damaging	1.00
R8762:Plppr4	UTSW	3	117325833	missense	probably damaging	1.00
R8784:Plppr4	UTSW	3	117322541	nonsense	probably null
R8933:Plppr4	UTSW	3	117323041	missense	probably damaging	1.00
R9251:Plppr4	UTSW	3	117321959	missense	probably benign	0.22
R9311:Plppr4	UTSW	3	117325869	missense	probably damaging	0.99
R9474:Plppr4	UTSW	3	117323217	missense	probably damaging	1.00
R9612:Plppr4	UTSW	3	117321961	missense	probably benign	0.07
R9709:Plppr4	UTSW	3	117328327	missense	possibly damaging	0.83
Z1176:Plppr4	UTSW	3	117322849	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCGATGACCTGCATGATG -3'
(R):5'- ATGCCTCTATGGATTCTGCC -3'

Sequencing Primer
(F):5'- TACAGGCCACGGTCTTCTCAG -3'
(R):5'- TATGGATTCTGCCCGGTCCAAAC -3'

Posted On

2022-04-18