Incidental Mutation 'R9385:Ank2'
ID 710248
Institutional Source Beutler Lab
Gene Symbol Ank2
Ensembl Gene ENSMUSG00000032826
Gene Name ankyrin 2, brain
Synonyms Ankyrin-B, Ank-2, Ankyrin-2, Gm4392, ankyrin B
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 126921612-127499350 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126959717 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 305 (V305A)
Ref Sequence ENSEMBL: ENSMUSP00000043765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044443] [ENSMUST00000182064] [ENSMUST00000182078] [ENSMUST00000182711] [ENSMUST00000182959]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044443
AA Change: V305A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000043765
Gene: ENSMUSG00000032826
AA Change: V305A

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
ZU5 128 232 4.13e-61 SMART
Pfam:ZU5 289 374 2.8e-8 PFAM
low complexity region 587 597 N/A INTRINSIC
DEATH 603 697 1.52e-27 SMART
low complexity region 732 748 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182025
Predicted Effect probably benign
Transcript: ENSMUST00000182062
Predicted Effect
SMART Domains Protein: ENSMUSP00000138620
Gene: ENSMUSG00000032826
AA Change: V1176A

DomainStartEndE-ValueType
ANK 9 38 1e1 SMART
ANK 42 71 8.9e-7 SMART
ANK 75 104 4.4e-9 SMART
ANK 108 137 2.8e-9 SMART
ANK 141 169 5.3e-1 SMART
ANK 170 199 7.3e-1 SMART
ANK 211 240 1.1e-7 SMART
ANK 244 273 4.4e-9 SMART
ANK 277 306 9.3e-8 SMART
ANK 310 339 2.1e-8 SMART
ANK 343 372 1.3e-7 SMART
ANK 376 405 6.2e-9 SMART
ANK 409 438 1.1e-7 SMART
ANK 442 471 2.9e-8 SMART
ANK 475 504 1.1e-5 SMART
ANK 508 537 6.5e-6 SMART
ANK 541 570 2.3e-7 SMART
ANK 574 603 2.4e-7 SMART
ANK 607 636 3.2e-9 SMART
ANK 640 669 5.5e-5 SMART
ANK 673 702 1.9e-8 SMART
ANK 706 735 3.3e-9 SMART
low complexity region 755 775 N/A INTRINSIC
low complexity region 793 806 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
ZU5 912 1016 2e-63 SMART
low complexity region 1371 1381 N/A INTRINSIC
low complexity region 1448 1463 N/A INTRINSIC
low complexity region 1490 1503 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182078
AA Change: V1089A
SMART Domains Protein: ENSMUSP00000138753
Gene: ENSMUSG00000032826
AA Change: V1089A

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 114 125 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 304 312 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
DEATH 591 685 1e-29 SMART
low complexity region 720 736 N/A INTRINSIC
low complexity region 848 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182711
AA Change: V1171A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000138781
Gene: ENSMUSG00000032826
AA Change: V1171A

DomainStartEndE-ValueType
ANK 26 55 1e1 SMART
ANK 59 88 8.9e-7 SMART
ANK 92 121 4.4e-9 SMART
ANK 125 154 2.8e-9 SMART
ANK 158 186 5.3e-1 SMART
ANK 187 216 7.3e-1 SMART
ANK 228 257 1.1e-7 SMART
ANK 261 290 4.4e-9 SMART
ANK 294 323 9.3e-8 SMART
ANK 327 356 2.1e-8 SMART
ANK 360 389 1.3e-7 SMART
ANK 393 422 6.2e-9 SMART
ANK 426 455 1.1e-7 SMART
ANK 459 488 2.9e-8 SMART
ANK 492 521 1.1e-5 SMART
ANK 525 554 6.5e-6 SMART
ANK 558 587 2.3e-7 SMART
ANK 591 620 5.3e-7 SMART
ANK 624 653 2.4e-7 SMART
ANK 657 686 3.2e-9 SMART
ANK 690 719 5.5e-5 SMART
ANK 723 752 1.9e-8 SMART
ANK 756 785 3.3e-9 SMART
low complexity region 805 825 N/A INTRINSIC
low complexity region 843 856 N/A INTRINSIC
ZU5 961 1098 1.1e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182959
SMART Domains Protein: ENSMUSP00000138251
Gene: ENSMUSG00000032826

DomainStartEndE-ValueType
ANK 9 38 1.63e3 SMART
ANK 42 71 1.4e-4 SMART
ANK 75 104 6.76e-7 SMART
ANK 108 137 4.46e-7 SMART
ANK 141 169 8.36e1 SMART
ANK 170 199 1.17e2 SMART
ANK 211 240 1.76e-5 SMART
ANK 244 273 6.76e-7 SMART
ANK 277 306 1.43e-5 SMART
ANK 310 339 3.33e-6 SMART
ANK 343 372 2.02e-5 SMART
ANK 376 405 9.55e-7 SMART
ANK 409 438 1.76e-5 SMART
ANK 442 471 4.71e-6 SMART
ANK 475 504 1.7e-3 SMART
ANK 508 537 1.05e-3 SMART
ANK 541 570 3.51e-5 SMART
ANK 574 603 8.65e-5 SMART
ANK 607 636 3.76e-5 SMART
ANK 640 669 5.12e-7 SMART
ANK 673 702 8.39e-3 SMART
ANK 706 735 2.9e-6 SMART
ANK 739 768 5.12e-7 SMART
low complexity region 788 808 N/A INTRINSIC
low complexity region 826 839 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
Pfam:ZU5 945 1028 1.5e-30 PFAM
Pfam:ZU5 1021 1082 4.4e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in death by postnatal day 8, although some animals survive to P20. Mutant animals display reduced body size, impaired balance and locomotion, brain structure dysmorphologies, abnormal lens, and optic nerve degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,161,192 I554T possibly damaging Het
4930435E12Rik T G 16: 38,828,045 D234A probably benign Het
Adamts7 C A 9: 90,195,205 C1308* probably null Het
Apob A G 12: 8,006,399 N1627S possibly damaging Het
Atp10a A T 7: 58,828,139 Q1310L probably benign Het
Atp8b4 A T 2: 126,480,631 Y29* probably null Het
Card11 C A 5: 140,885,521 R742S probably benign Het
Ccdc88a A G 11: 29,455,422 D365G probably benign Het
Ccdc88b G A 19: 6,856,165 R211W probably benign Het
Cda T G 4: 138,351,287 I55L probably benign Het
Cdkl3 A C 11: 52,035,952 E577D probably benign Het
Cel T C 2: 28,560,575 D146G probably damaging Het
Cmya5 A G 13: 93,094,372 S1403P probably damaging Het
Cntn2 G A 1: 132,528,174 S202L probably damaging Het
Col15a1 C T 4: 47,300,473 Q1045* probably null Het
Csmd1 T C 8: 15,984,756 T2472A probably benign Het
Ctbp2 G A 7: 132,999,340 R22C probably benign Het
Ddit4 A G 10: 59,951,356 S53P probably damaging Het
Ddx52 G T 11: 83,952,270 C365F probably damaging Het
Dnhd1 C A 7: 105,712,765 L3677I probably damaging Het
Dscam T C 16: 97,039,003 T135A probably benign Het
Espl1 T A 15: 102,298,750 D216E probably damaging Het
Fsip2 T A 2: 82,989,449 D5175E possibly damaging Het
Fxr1 A G 3: 34,019,971 probably benign Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gm3264 T C 14: 4,871,178 I8T possibly damaging Het
Gm35339 A G 15: 76,356,167 T352A Het
Gsdmc A T 15: 63,803,637 Y110N possibly damaging Het
H13 A G 2: 152,695,493 N286S probably benign Het
Heatr1 A G 13: 12,406,542 D441G probably damaging Het
Hist1h2aa A T 13: 23,934,696 I79F probably damaging Het
Hps6 A G 19: 46,005,910 D762G probably damaging Het
Hyou1 C A 9: 44,381,515 Q141K probably benign Het
Lpin3 T C 2: 160,897,073 I267T probably benign Het
Mdc1 A G 17: 35,850,504 K770E probably benign Het
Mlh3 C T 12: 85,269,370 R14H probably damaging Het
Nfxl1 C A 5: 72,537,407 V478F probably benign Het
Nhlrc3 A G 3: 53,453,594 W247R probably damaging Het
Nlrc3 C T 16: 3,964,012 G527D probably damaging Het
Nop9 A G 14: 55,751,127 E342G probably benign Het
Ntn1 C A 11: 68,385,187 G312C probably damaging Het
Olfr288 C T 15: 98,187,605 S64N probably damaging Het
Olfr474 T A 7: 107,955,573 *311K probably null Het
Opcml T C 9: 28,675,163 V59A possibly damaging Het
Opn1sw T G 6: 29,379,426 Y193S probably damaging Het
Pabpc4l A T 3: 46,446,702 V169E probably damaging Het
Pde3a A G 6: 141,492,256 D1017G probably benign Het
Plagl2 C T 2: 153,232,318 C221Y probably damaging Het
Plppr4 G T 3: 117,322,728 N493K possibly damaging Het
Plxna2 T C 1: 194,749,416 V571A possibly damaging Het
Pnma2 A G 14: 66,915,922 probably benign Het
Rnf123 T A 9: 108,052,268 E1234D probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc22a23 T C 13: 34,344,578 S74G probably benign Het
Slc36a4 T C 9: 15,734,267 I330T probably damaging Het
Snrk A T 9: 122,166,397 D414V probably benign Het
Snrnp200 G A 2: 127,238,058 probably null Het
Spata31d1b T C 13: 59,715,589 S184P probably damaging Het
Tas2r140 A T 6: 133,055,278 N172K probably benign Het
Tbc1d4 G T 14: 101,462,920 Q858K probably damaging Het
Tial1 A G 7: 128,442,485 C102R unknown Het
Ugt8a A T 3: 125,871,614 D411E probably benign Het
Usp34 A G 11: 23,449,223 D2404G Het
Vmn1r10 A C 6: 57,113,848 I142L probably benign Het
Wdr66 T C 5: 123,288,815 L919S probably damaging Het
Xpo7 A T 14: 70,688,293 D435E probably damaging Het
Zmym1 A G 4: 127,058,890 S33P probably damaging Het
Other mutations in Ank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Ank2 APN 3 126959720 missense possibly damaging 0.80
IGL01652:Ank2 APN 3 126933041 missense probably benign 0.00
IGL01969:Ank2 APN 3 126953223 missense possibly damaging 0.47
IGL02122:Ank2 APN 3 126937874 splice site probably benign
IGL02537:Ank2 APN 3 126955916 missense probably damaging 1.00
IGL02858:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL02981:Ank2 APN 3 126934562 missense possibly damaging 0.58
IGL02981:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03024:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03074:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03111:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03129:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03174:Ank2 APN 3 126940095 missense probably damaging 0.98
IGL03177:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03185:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03188:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03242:Ank2 APN 3 126928805 missense possibly damaging 0.90
IGL03244:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03248:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03285:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03304:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03358:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03380:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03389:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03400:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03409:Ank2 APN 3 126955870 missense probably damaging 1.00
ballast UTSW 3 126943133 missense unknown
Chain UTSW 3 126946938 intron probably benign
Deadman UTSW 3 126929822 missense probably benign 0.19
drag UTSW 3 127003982 missense probably damaging 1.00
mooring UTSW 3 126934577 missense possibly damaging 0.73
Treasure UTSW 3 126946749 missense unknown
Windlass UTSW 3 126946149 missense probably benign
R0033:Ank2 UTSW 3 127104748 splice site probably benign
R0042:Ank2 UTSW 3 126936631 missense probably damaging 0.99
R0042:Ank2 UTSW 3 126936631 missense probably damaging 0.99
R0079:Ank2 UTSW 3 126934615 missense probably benign 0.01
R0423:Ank2 UTSW 3 126929860 nonsense probably null
R0699:Ank2 UTSW 3 126929829 missense probably benign 0.00
R0724:Ank2 UTSW 3 126962337 missense probably damaging 1.00
R0990:Ank2 UTSW 3 126934666 missense possibly damaging 0.64
R1450:Ank2 UTSW 3 126957302 missense possibly damaging 0.94
R1500:Ank2 UTSW 3 126932982 missense probably benign
R1702:Ank2 UTSW 3 126955899 missense probably benign 0.00
R1703:Ank2 UTSW 3 126929766 missense probably damaging 1.00
R1710:Ank2 UTSW 3 126933060 nonsense probably null
R1743:Ank2 UTSW 3 126928675 missense probably damaging 0.99
R1775:Ank2 UTSW 3 126934547 missense probably benign 0.00
R1852:Ank2 UTSW 3 126997851 critical splice donor site probably null
R2198:Ank2 UTSW 3 126934577 missense possibly damaging 0.73
R2892:Ank2 UTSW 3 127248243 splice site probably null
R2893:Ank2 UTSW 3 127248243 splice site probably null
R2894:Ank2 UTSW 3 127248243 splice site probably null
R3148:Ank2 UTSW 3 126933075 missense probably benign 0.00
R3776:Ank2 UTSW 3 126942262 intron probably benign
R3784:Ank2 UTSW 3 126953193 missense probably damaging 1.00
R3856:Ank2 UTSW 3 126929844 missense probably benign 0.00
R3906:Ank2 UTSW 3 127016898 missense probably damaging 1.00
R3907:Ank2 UTSW 3 127016898 missense probably damaging 1.00
R3953:Ank2 UTSW 3 126988160 missense probably damaging 1.00
R3963:Ank2 UTSW 3 126934596 missense probably benign
R4367:Ank2 UTSW 3 126946149 missense probably benign
R4414:Ank2 UTSW 3 127225762 critical splice donor site probably null
R4432:Ank2 UTSW 3 126947806 intron probably benign
R4433:Ank2 UTSW 3 126947806 intron probably benign
R4579:Ank2 UTSW 3 126958963 missense probably damaging 1.00
R4597:Ank2 UTSW 3 126988151 missense probably damaging 1.00
R4603:Ank2 UTSW 3 127032016 missense probably benign 0.00
R4729:Ank2 UTSW 3 126976896 nonsense probably null
R4815:Ank2 UTSW 3 126936761 missense probably benign
R4826:Ank2 UTSW 3 126956001 missense probably benign 0.35
R4871:Ank2 UTSW 3 126959795 missense probably damaging 1.00
R4880:Ank2 UTSW 3 127046826 splice site probably null
R4915:Ank2 UTSW 3 126942671 intron probably benign
R4935:Ank2 UTSW 3 126956064 missense probably damaging 1.00
R4936:Ank2 UTSW 3 126955039 missense possibly damaging 0.94
R4937:Ank2 UTSW 3 126962401 missense probably damaging 1.00
R4946:Ank2 UTSW 3 126941940 intron probably benign
R4963:Ank2 UTSW 3 127032096 missense probably benign 0.01
R4989:Ank2 UTSW 3 126963445 missense possibly damaging 0.94
R5023:Ank2 UTSW 3 126941871 intron probably benign
R5060:Ank2 UTSW 3 126945921 intron probably benign
R5078:Ank2 UTSW 3 126942353 intron probably benign
R5086:Ank2 UTSW 3 126947348 intron probably benign
R5134:Ank2 UTSW 3 126963445 missense possibly damaging 0.94
R5148:Ank2 UTSW 3 127025636 splice site probably null
R5175:Ank2 UTSW 3 127004024 missense probably damaging 1.00
R5275:Ank2 UTSW 3 127032183 missense probably damaging 1.00
R5295:Ank2 UTSW 3 127032183 missense probably damaging 1.00
R5303:Ank2 UTSW 3 126945804 intron probably benign
R5309:Ank2 UTSW 3 126959768 missense probably damaging 0.99
R5312:Ank2 UTSW 3 126959768 missense probably damaging 0.99
R5352:Ank2 UTSW 3 127498991 utr 5 prime probably benign
R5355:Ank2 UTSW 3 126944049 intron probably benign
R5386:Ank2 UTSW 3 126981933 missense probably benign 0.01
R5396:Ank2 UTSW 3 126953226 missense probably damaging 1.00
R5518:Ank2 UTSW 3 126959699 missense probably damaging 0.98
R5534:Ank2 UTSW 3 126947298 intron probably benign
R5554:Ank2 UTSW 3 126998973 missense possibly damaging 0.78
R5582:Ank2 UTSW 3 126946305 intron probably benign
R5747:Ank2 UTSW 3 126941751 intron probably benign
R5794:Ank2 UTSW 3 126930020 missense probably benign 0.00
R5831:Ank2 UTSW 3 127339159 start gained probably benign
R5925:Ank2 UTSW 3 126932963 missense probably benign 0.18
R5954:Ank2 UTSW 3 126997861 missense probably benign 0.34
R5956:Ank2 UTSW 3 126942688 intron probably benign
R5986:Ank2 UTSW 3 127012686 missense possibly damaging 0.94
R5992:Ank2 UTSW 3 126959651 critical splice donor site probably null
R6020:Ank2 UTSW 3 126946821 intron probably benign
R6027:Ank2 UTSW 3 126997879 missense possibly damaging 0.92
R6049:Ank2 UTSW 3 126943020 missense possibly damaging 0.95
R6060:Ank2 UTSW 3 126955952 missense probably damaging 1.00
R6114:Ank2 UTSW 3 127011051 missense probably damaging 1.00
R6124:Ank2 UTSW 3 127248151 missense probably benign 0.31
R6156:Ank2 UTSW 3 126944237 missense probably damaging 1.00
R6173:Ank2 UTSW 3 127052746 missense probably damaging 1.00
R6176:Ank2 UTSW 3 126945471 missense probably benign 0.05
R6184:Ank2 UTSW 3 126962398 missense probably damaging 1.00
R6199:Ank2 UTSW 3 127004006 missense probably damaging 1.00
R6241:Ank2 UTSW 3 127052748 missense probably damaging 1.00
R6254:Ank2 UTSW 3 126941804 intron probably benign
R6259:Ank2 UTSW 3 127016986 missense probably benign 0.28
R6260:Ank2 UTSW 3 126943557 missense probably benign
R6321:Ank2 UTSW 3 126946938 intron probably benign
R6393:Ank2 UTSW 3 126929757 missense probably damaging 1.00
R6406:Ank2 UTSW 3 127032225 missense probably damaging 1.00
R6544:Ank2 UTSW 3 126933222 missense probably damaging 0.99
R6583:Ank2 UTSW 3 127016964 missense probably damaging 1.00
R6739:Ank2 UTSW 3 127079994 missense probably damaging 1.00
R6754:Ank2 UTSW 3 127096839 intron probably benign
R6786:Ank2 UTSW 3 126958932 missense probably damaging 0.99
R6798:Ank2 UTSW 3 126944264 intron probably benign
R6882:Ank2 UTSW 3 126945757 intron probably benign
R6940:Ank2 UTSW 3 126941972 intron probably benign
R6949:Ank2 UTSW 3 127010884 missense probably benign 0.00
R7001:Ank2 UTSW 3 127077581 missense probably damaging 1.00
R7033:Ank2 UTSW 3 126944850 nonsense probably null
R7036:Ank2 UTSW 3 126946392 intron probably benign
R7045:Ank2 UTSW 3 127012744 missense probably damaging 1.00
R7048:Ank2 UTSW 3 127025618 missense probably benign 0.03
R7054:Ank2 UTSW 3 126943303 intron probably benign
R7069:Ank2 UTSW 3 126946298 intron probably benign
R7091:Ank2 UTSW 3 127023351 missense probably damaging 0.98
R7107:Ank2 UTSW 3 127003982 missense probably damaging 1.00
R7175:Ank2 UTSW 3 126946941 missense unknown
R7191:Ank2 UTSW 3 126946392 missense unknown
R7272:Ank2 UTSW 3 126943133 missense unknown
R7381:Ank2 UTSW 3 126936628 missense possibly damaging 0.46
R7394:Ank2 UTSW 3 126936653 missense possibly damaging 0.77
R7462:Ank2 UTSW 3 126943034 missense unknown
R7490:Ank2 UTSW 3 126958889 missense probably damaging 0.99
R7514:Ank2 UTSW 3 127025603 missense probably benign 0.06
R7534:Ank2 UTSW 3 126934333 splice site probably null
R7540:Ank2 UTSW 3 126988159 missense possibly damaging 0.94
R7547:Ank2 UTSW 3 126945203 missense unknown
R7579:Ank2 UTSW 3 126946398 missense unknown
R7584:Ank2 UTSW 3 126946128 nonsense probably null
R7625:Ank2 UTSW 3 127052800 missense probably damaging 1.00
R7698:Ank2 UTSW 3 127032211 missense probably benign 0.35
R7716:Ank2 UTSW 3 126943166 missense unknown
R7718:Ank2 UTSW 3 126965013 missense possibly damaging 0.88
R7722:Ank2 UTSW 3 127029302 missense probably benign 0.01
R7738:Ank2 UTSW 3 126947622 missense
R7977:Ank2 UTSW 3 126945707 missense unknown
R7987:Ank2 UTSW 3 126945707 missense unknown
R8007:Ank2 UTSW 3 126936447 intron probably benign
R8150:Ank2 UTSW 3 126947513 missense
R8161:Ank2 UTSW 3 127032129 missense
R8196:Ank2 UTSW 3 126929883 missense probably damaging 0.99
R8248:Ank2 UTSW 3 126937785 missense possibly damaging 0.78
R8255:Ank2 UTSW 3 126946749 missense unknown
R8279:Ank2 UTSW 3 126933171 missense probably benign 0.04
R8300:Ank2 UTSW 3 127010906 missense
R8716:Ank2 UTSW 3 126942839 nonsense probably null
R8724:Ank2 UTSW 3 126943756 missense unknown
R8765:Ank2 UTSW 3 127057082 missense possibly damaging 0.94
R8779:Ank2 UTSW 3 126965102 missense probably damaging 0.99
R8783:Ank2 UTSW 3 127052806 missense probably damaging 1.00
R8785:Ank2 UTSW 3 126997921 missense probably damaging 1.00
R8826:Ank2 UTSW 3 126947302 missense unknown
R8872:Ank2 UTSW 3 126997876 missense possibly damaging 0.88
R8903:Ank2 UTSW 3 127046782 missense probably damaging 1.00
R8906:Ank2 UTSW 3 126933071 missense probably benign 0.00
R8918:Ank2 UTSW 3 126943731 missense unknown
R8947:Ank2 UTSW 3 126942747 intron probably benign
R8977:Ank2 UTSW 3 126944926 missense unknown
R8990:Ank2 UTSW 3 127048180 critical splice donor site probably null
R8994:Ank2 UTSW 3 126929822 missense probably benign 0.19
R9009:Ank2 UTSW 3 126934376 unclassified probably benign
R9123:Ank2 UTSW 3 126940095 missense probably damaging 1.00
R9125:Ank2 UTSW 3 126940095 missense probably damaging 1.00
R9130:Ank2 UTSW 3 127016916 missense
R9175:Ank2 UTSW 3 126928753 missense possibly damaging 0.52
R9220:Ank2 UTSW 3 126943437 missense unknown
R9225:Ank2 UTSW 3 126942462 missense unknown
R9286:Ank2 UTSW 3 127052732 missense probably damaging 0.99
R9325:Ank2 UTSW 3 126981855 missense probably damaging 0.98
R9367:Ank2 UTSW 3 126945029 missense unknown
R9391:Ank2 UTSW 3 126937745 missense probably damaging 0.99
R9422:Ank2 UTSW 3 127096856 missense unknown
R9536:Ank2 UTSW 3 126942382 missense unknown
R9647:Ank2 UTSW 3 126998974 missense possibly damaging 0.93
R9650:Ank2 UTSW 3 126942180 missense unknown
R9666:Ank2 UTSW 3 126933189 nonsense probably null
R9686:Ank2 UTSW 3 126946901 missense unknown
R9730:Ank2 UTSW 3 127225844 missense
R9738:Ank2 UTSW 3 126943472 missense unknown
R9743:Ank2 UTSW 3 126940145 missense possibly damaging 0.81
R9747:Ank2 UTSW 3 126959018 missense probably damaging 1.00
R9800:Ank2 UTSW 3 126946500 missense unknown
R9803:Ank2 UTSW 3 126959077 missense possibly damaging 0.64
RF020:Ank2 UTSW 3 126945476 missense unknown
Z1088:Ank2 UTSW 3 127029509 missense possibly damaging 0.45
Z1177:Ank2 UTSW 3 126944357 missense unknown
Z1187:Ank2 UTSW 3 126955952 missense probably damaging 1.00
Z1190:Ank2 UTSW 3 126955952 missense probably damaging 1.00
Z1192:Ank2 UTSW 3 126955952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGGCCTTTGTTCATTCAGGAAAG -3'
(R):5'- CCGTGAGTCTGCTAGAACGTTC -3'

Sequencing Primer
(F):5'- CAGGAAAGCTTTATTTCGGTGAC -3'
(R):5'- TGCTAGAACGTTCTCAGGAGTCAC -3'
Posted On 2022-04-18