Incidental Mutation 'R9385:Wdr66'
ID 710253
Institutional Source Beutler Lab
Gene Symbol Wdr66
Ensembl Gene ENSMUSG00000029442
Gene Name WD repeat domain 66
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R9385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 123252102-123327484 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123288815 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 919 (L919S)
Ref Sequence ENSEMBL: ENSMUSP00000113309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121964] [ENSMUST00000163092] [ENSMUST00000170536]
AlphaFold E9Q743
Predicted Effect probably damaging
Transcript: ENSMUST00000121964
AA Change: L919S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113309
Gene: ENSMUSG00000029442
AA Change: L919S

DomainStartEndE-ValueType
coiled coil region 9 160 N/A INTRINSIC
coiled coil region 243 299 N/A INTRINSIC
WD40 437 478 1.58e-2 SMART
WD40 481 525 6.16e0 SMART
Blast:WD40 532 572 2e-15 BLAST
Blast:WD40 584 623 5e-17 BLAST
low complexity region 627 641 N/A INTRINSIC
WD40 643 677 7.64e1 SMART
Blast:WD40 686 742 1e-13 BLAST
WD40 745 784 8.62e-4 SMART
WD40 789 827 1.19e1 SMART
WD40 832 871 5.97e-1 SMART
WD40 880 923 1.23e2 SMART
WD40 1030 1070 1.15e0 SMART
low complexity region 1274 1285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150155
Predicted Effect probably damaging
Transcript: ENSMUST00000163092
AA Change: L422S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126995
Gene: ENSMUSG00000029442
AA Change: L422S

DomainStartEndE-ValueType
Blast:WD40 1 28 3e-10 BLAST
Blast:WD40 35 75 2e-15 BLAST
Blast:WD40 87 126 3e-17 BLAST
low complexity region 130 144 N/A INTRINSIC
WD40 146 180 7.64e1 SMART
Blast:WD40 183 246 2e-14 BLAST
WD40 248 287 8.62e-4 SMART
WD40 292 330 1.19e1 SMART
WD40 335 374 5.97e-1 SMART
WD40 383 426 1.23e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170536
AA Change: L480S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129769
Gene: ENSMUSG00000029442
AA Change: L480S

DomainStartEndE-ValueType
WD40 42 86 3.18e1 SMART
Blast:WD40 93 133 1e-15 BLAST
Blast:WD40 145 184 3e-17 BLAST
low complexity region 188 202 N/A INTRINSIC
WD40 204 238 7.64e1 SMART
Blast:WD40 241 304 3e-14 BLAST
WD40 306 345 8.62e-4 SMART
WD40 350 388 1.19e1 SMART
WD40 393 432 5.97e-1 SMART
WD40 441 484 1.23e2 SMART
Blast:WD40 490 535 2e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member appears to function in the determination of mean platelet volume (MPV), and polymorphisms in this gene have been associated with variance in MPV. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,161,192 I554T possibly damaging Het
4930435E12Rik T G 16: 38,828,045 D234A probably benign Het
Adamts7 C A 9: 90,195,205 C1308* probably null Het
Ank2 A G 3: 126,959,717 V305A probably benign Het
Apob A G 12: 8,006,399 N1627S possibly damaging Het
Atp10a A T 7: 58,828,139 Q1310L probably benign Het
Atp8b4 A T 2: 126,480,631 Y29* probably null Het
Card11 C A 5: 140,885,521 R742S probably benign Het
Ccdc88a A G 11: 29,455,422 D365G probably benign Het
Ccdc88b G A 19: 6,856,165 R211W probably benign Het
Cda T G 4: 138,351,287 I55L probably benign Het
Cdkl3 A C 11: 52,035,952 E577D probably benign Het
Cel T C 2: 28,560,575 D146G probably damaging Het
Cmya5 A G 13: 93,094,372 S1403P probably damaging Het
Cntn2 G A 1: 132,528,174 S202L probably damaging Het
Col15a1 C T 4: 47,300,473 Q1045* probably null Het
Csmd1 T C 8: 15,984,756 T2472A probably benign Het
Ctbp2 G A 7: 132,999,340 R22C probably benign Het
Ddit4 A G 10: 59,951,356 S53P probably damaging Het
Ddx52 G T 11: 83,952,270 C365F probably damaging Het
Dnhd1 C A 7: 105,712,765 L3677I probably damaging Het
Dscam T C 16: 97,039,003 T135A probably benign Het
Espl1 T A 15: 102,298,750 D216E probably damaging Het
Fsip2 T A 2: 82,989,449 D5175E possibly damaging Het
Fxr1 A G 3: 34,019,971 probably benign Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gm3264 T C 14: 4,871,178 I8T possibly damaging Het
Gm35339 A G 15: 76,356,167 T352A Het
Gsdmc A T 15: 63,803,637 Y110N possibly damaging Het
H13 A G 2: 152,695,493 N286S probably benign Het
Heatr1 A G 13: 12,406,542 D441G probably damaging Het
Hist1h2aa A T 13: 23,934,696 I79F probably damaging Het
Hps6 A G 19: 46,005,910 D762G probably damaging Het
Hyou1 C A 9: 44,381,515 Q141K probably benign Het
Lpin3 T C 2: 160,897,073 I267T probably benign Het
Mdc1 A G 17: 35,850,504 K770E probably benign Het
Mlh3 C T 12: 85,269,370 R14H probably damaging Het
Nfxl1 C A 5: 72,537,407 V478F probably benign Het
Nhlrc3 A G 3: 53,453,594 W247R probably damaging Het
Nlrc3 C T 16: 3,964,012 G527D probably damaging Het
Nop9 A G 14: 55,751,127 E342G probably benign Het
Ntn1 C A 11: 68,385,187 G312C probably damaging Het
Olfr288 C T 15: 98,187,605 S64N probably damaging Het
Olfr474 T A 7: 107,955,573 *311K probably null Het
Opcml T C 9: 28,675,163 V59A possibly damaging Het
Opn1sw T G 6: 29,379,426 Y193S probably damaging Het
Pabpc4l A T 3: 46,446,702 V169E probably damaging Het
Pde3a A G 6: 141,492,256 D1017G probably benign Het
Plagl2 C T 2: 153,232,318 C221Y probably damaging Het
Plppr4 G T 3: 117,322,728 N493K possibly damaging Het
Plxna2 T C 1: 194,749,416 V571A possibly damaging Het
Pnma2 A G 14: 66,915,922 probably benign Het
Rnf123 T A 9: 108,052,268 E1234D probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc22a23 T C 13: 34,344,578 S74G probably benign Het
Slc36a4 T C 9: 15,734,267 I330T probably damaging Het
Snrk A T 9: 122,166,397 D414V probably benign Het
Snrnp200 G A 2: 127,238,058 probably null Het
Spata31d1b T C 13: 59,715,589 S184P probably damaging Het
Tas2r140 A T 6: 133,055,278 N172K probably benign Het
Tbc1d4 G T 14: 101,462,920 Q858K probably damaging Het
Tial1 A G 7: 128,442,485 C102R unknown Het
Ugt8a A T 3: 125,871,614 D411E probably benign Het
Usp34 A G 11: 23,449,223 D2404G Het
Vmn1r10 A C 6: 57,113,848 I142L probably benign Het
Xpo7 A T 14: 70,688,293 D435E probably damaging Het
Zmym1 A G 4: 127,058,890 S33P probably damaging Het
Other mutations in Wdr66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Wdr66 APN 5 123274177 missense probably damaging 1.00
IGL01090:Wdr66 APN 5 123279989 splice site probably benign
IGL01387:Wdr66 APN 5 123283546 missense probably damaging 1.00
IGL01432:Wdr66 APN 5 123279952 missense possibly damaging 0.88
IGL01642:Wdr66 APN 5 123288698 missense possibly damaging 0.77
IGL01720:Wdr66 APN 5 123322494 missense probably benign 0.07
IGL02104:Wdr66 APN 5 123302698 nonsense probably null
IGL02160:Wdr66 APN 5 123256018 missense unknown
IGL02238:Wdr66 APN 5 123302423 missense probably damaging 1.00
IGL02820:Wdr66 APN 5 123254636 unclassified probably benign
IGL03183:Wdr66 APN 5 123254619 unclassified probably benign
R0078:Wdr66 UTSW 5 123298570 missense probably benign 0.04
R0207:Wdr66 UTSW 5 123283447 missense probably damaging 0.98
R0411:Wdr66 UTSW 5 123290054 missense probably damaging 1.00
R0414:Wdr66 UTSW 5 123287413 splice site probably null
R0722:Wdr66 UTSW 5 123256185 missense probably damaging 1.00
R1169:Wdr66 UTSW 5 123254610 small deletion probably benign
R1527:Wdr66 UTSW 5 123287345 missense probably benign 0.19
R1924:Wdr66 UTSW 5 123302739 missense possibly damaging 0.67
R2022:Wdr66 UTSW 5 123273790 missense probably benign 0.29
R2110:Wdr66 UTSW 5 123254375 unclassified probably benign
R2112:Wdr66 UTSW 5 123254375 unclassified probably benign
R2147:Wdr66 UTSW 5 123256191 missense probably benign 0.01
R2258:Wdr66 UTSW 5 123283348 splice site probably null
R2407:Wdr66 UTSW 5 123289969 missense probably benign 0.11
R2418:Wdr66 UTSW 5 123254268 unclassified probably benign
R2497:Wdr66 UTSW 5 123283369 missense probably damaging 1.00
R2509:Wdr66 UTSW 5 123256106 missense probably benign 0.00
R3437:Wdr66 UTSW 5 123254372 unclassified probably benign
R3730:Wdr66 UTSW 5 123326568 missense possibly damaging 0.70
R3800:Wdr66 UTSW 5 123254721 unclassified probably benign
R4018:Wdr66 UTSW 5 123322454 missense probably benign 0.04
R4181:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4302:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4640:Wdr66 UTSW 5 123302432 missense probably benign 0.00
R4701:Wdr66 UTSW 5 123322613 missense probably benign 0.00
R4799:Wdr66 UTSW 5 123302772 missense probably benign 0.04
R4812:Wdr66 UTSW 5 123287305 missense probably benign 0.01
R4922:Wdr66 UTSW 5 123256053 missense probably benign 0.00
R5123:Wdr66 UTSW 5 123273633 start gained probably benign
R5314:Wdr66 UTSW 5 123322563 missense probably benign 0.01
R5445:Wdr66 UTSW 5 123287177 missense probably damaging 1.00
R5458:Wdr66 UTSW 5 123254445 unclassified probably benign
R5462:Wdr66 UTSW 5 123298632 critical splice donor site probably null
R5514:Wdr66 UTSW 5 123287766 critical splice donor site probably null
R5600:Wdr66 UTSW 5 123288698 missense possibly damaging 0.77
R5635:Wdr66 UTSW 5 123322572 missense probably benign 0.25
R5767:Wdr66 UTSW 5 123298521 missense probably benign 0.01
R5943:Wdr66 UTSW 5 123286357 missense probably benign 0.13
R6000:Wdr66 UTSW 5 123254372 unclassified probably benign
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6293:Wdr66 UTSW 5 123322448 missense probably damaging 1.00
R6354:Wdr66 UTSW 5 123302755 missense probably damaging 0.99
R6356:Wdr66 UTSW 5 123254666 unclassified probably benign
R6427:Wdr66 UTSW 5 123326533 missense probably damaging 1.00
R6896:Wdr66 UTSW 5 123278358 missense possibly damaging 0.81
R6909:Wdr66 UTSW 5 123287752 missense probably damaging 1.00
R7503:Wdr66 UTSW 5 123297458 nonsense probably null
R7707:Wdr66 UTSW 5 123253887 missense probably benign 0.00
R7715:Wdr66 UTSW 5 123262134 missense probably damaging 1.00
R7809:Wdr66 UTSW 5 123264831 missense probably damaging 1.00
R7819:Wdr66 UTSW 5 123254259 unclassified probably benign
R7842:Wdr66 UTSW 5 123254424 missense unknown
R7898:Wdr66 UTSW 5 123322454 missense probably damaging 0.99
R7967:Wdr66 UTSW 5 123283516 missense possibly damaging 0.89
R8004:Wdr66 UTSW 5 123254450 missense unknown
R8068:Wdr66 UTSW 5 123256166 missense not run
R8141:Wdr66 UTSW 5 123286430 missense possibly damaging 0.83
R8222:Wdr66 UTSW 5 123302423 missense probably damaging 1.00
R8242:Wdr66 UTSW 5 123273851 missense possibly damaging 0.89
R8303:Wdr66 UTSW 5 123322587 missense probably damaging 0.99
R8323:Wdr66 UTSW 5 123297525 missense probably benign 0.16
R8773:Wdr66 UTSW 5 123273850 missense probably benign 0.12
R8869:Wdr66 UTSW 5 123322442 missense possibly damaging 0.48
R8881:Wdr66 UTSW 5 123324375 missense probably damaging 1.00
R8921:Wdr66 UTSW 5 123286418 missense possibly damaging 0.71
R9099:Wdr66 UTSW 5 123280019 intron probably benign
R9236:Wdr66 UTSW 5 123290062 missense probably damaging 1.00
R9627:Wdr66 UTSW 5 123322494 missense probably benign 0.07
R9762:Wdr66 UTSW 5 123322470 missense probably damaging 1.00
RF007:Wdr66 UTSW 5 123254254 small insertion probably benign
RF010:Wdr66 UTSW 5 123274161 critical splice acceptor site probably benign
RF015:Wdr66 UTSW 5 123254242 small insertion probably benign
RF015:Wdr66 UTSW 5 123274161 critical splice acceptor site probably benign
RF017:Wdr66 UTSW 5 123253890 small insertion probably benign
RF024:Wdr66 UTSW 5 123253883 small insertion probably benign
RF024:Wdr66 UTSW 5 123253888 small insertion probably benign
RF024:Wdr66 UTSW 5 123253889 small insertion probably benign
X0062:Wdr66 UTSW 5 123274237 missense probably benign 0.29
X0066:Wdr66 UTSW 5 123288647 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAGGTCCTAAAGTTAAGGGAACGAC -3'
(R):5'- ACCTCAGAGATGCCAATGTG -3'

Sequencing Primer
(F):5'- AGTTAAGGGAACGACTTCTGCTC -3'
(R):5'- GTCTACACAAGATGCCAG -3'
Posted On 2022-04-18