Incidental Mutation 'R9385:Pde3a'
ID 710258
Institutional Source Beutler Lab
Gene Symbol Pde3a
Ensembl Gene ENSMUSG00000041741
Gene Name phosphodiesterase 3A, cGMP inhibited
Synonyms A930022O17Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.271) question?
Stock # R9385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 141194995-141452588 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 141437982 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1017 (D1017G)
Ref Sequence ENSEMBL: ENSMUSP00000038749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043259]
AlphaFold Q9Z0X4
Predicted Effect probably benign
Transcript: ENSMUST00000043259
AA Change: D1017G

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741
AA Change: D1017G

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 103 121 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 230 252 N/A INTRINSIC
low complexity region 419 445 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
HDc 749 964 3.76e-4 SMART
low complexity region 1028 1056 N/A INTRINSIC
low complexity region 1114 1133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,207,966 (GRCm39) I554T possibly damaging Het
Adamts7 C A 9: 90,077,258 (GRCm39) C1308* probably null Het
Ank2 A G 3: 126,753,366 (GRCm39) V305A probably benign Het
Apob A G 12: 8,056,399 (GRCm39) N1627S possibly damaging Het
Atp10a A T 7: 58,477,887 (GRCm39) Q1310L probably benign Het
Atp8b4 A T 2: 126,322,551 (GRCm39) Y29* probably null Het
Card11 C A 5: 140,871,276 (GRCm39) R742S probably benign Het
Ccdc88a A G 11: 29,405,422 (GRCm39) D365G probably benign Het
Ccdc88b G A 19: 6,833,533 (GRCm39) R211W probably benign Het
Cda T G 4: 138,078,598 (GRCm39) I55L probably benign Het
Cdkl3 A C 11: 51,926,779 (GRCm39) E577D probably benign Het
Cel T C 2: 28,450,587 (GRCm39) D146G probably damaging Het
Cfap251 T C 5: 123,426,878 (GRCm39) L919S probably damaging Het
Cmya5 A G 13: 93,230,880 (GRCm39) S1403P probably damaging Het
Cntn2 G A 1: 132,455,912 (GRCm39) S202L probably damaging Het
Col15a1 C T 4: 47,300,473 (GRCm39) Q1045* probably null Het
Csmd1 T C 8: 16,034,756 (GRCm39) T2472A probably benign Het
Ctbp2 G A 7: 132,601,069 (GRCm39) R22C probably benign Het
Ddit4 A G 10: 59,787,178 (GRCm39) S53P probably damaging Het
Ddx52 G T 11: 83,843,096 (GRCm39) C365F probably damaging Het
Dnhd1 C A 7: 105,361,972 (GRCm39) L3677I probably damaging Het
Dscam T C 16: 96,840,203 (GRCm39) T135A probably benign Het
Espl1 T A 15: 102,207,185 (GRCm39) D216E probably damaging Het
Fsip2 T A 2: 82,819,793 (GRCm39) D5175E possibly damaging Het
Fxr1 A G 3: 34,074,120 (GRCm39) probably benign Het
Fyb1 A G 15: 6,664,297 (GRCm39) D460G probably benign Het
Gm3264 T C 14: 16,058,217 (GRCm39) I8T possibly damaging Het
Gsdmc A T 15: 63,675,486 (GRCm39) Y110N possibly damaging Het
H13 A G 2: 152,537,413 (GRCm39) N286S probably benign Het
H2ac1 A T 13: 24,118,679 (GRCm39) I79F probably damaging Het
Heatr1 A G 13: 12,421,423 (GRCm39) D441G probably damaging Het
Hps6 A G 19: 45,994,349 (GRCm39) D762G probably damaging Het
Hyou1 C A 9: 44,292,812 (GRCm39) Q141K probably benign Het
Lpin3 T C 2: 160,738,993 (GRCm39) I267T probably benign Het
Mdc1 A G 17: 36,161,396 (GRCm39) K770E probably benign Het
Mlh3 C T 12: 85,316,144 (GRCm39) R14H probably damaging Het
Nfxl1 C A 5: 72,694,750 (GRCm39) V478F probably benign Het
Nhlrc3 A G 3: 53,361,015 (GRCm39) W247R probably damaging Het
Nlrc3 C T 16: 3,781,876 (GRCm39) G527D probably damaging Het
Nop9 A G 14: 55,988,584 (GRCm39) E342G probably benign Het
Ntn1 C A 11: 68,276,013 (GRCm39) G312C probably damaging Het
Opcml T C 9: 28,586,459 (GRCm39) V59A possibly damaging Het
Opn1sw T G 6: 29,379,425 (GRCm39) Y193S probably damaging Het
Or10ad1c C T 15: 98,085,486 (GRCm39) S64N probably damaging Het
Or5p54 T A 7: 107,554,780 (GRCm39) *311K probably null Het
Pabpc4l A T 3: 46,401,137 (GRCm39) V169E probably damaging Het
Plagl2 C T 2: 153,074,238 (GRCm39) C221Y probably damaging Het
Plppr4 G T 3: 117,116,377 (GRCm39) N493K possibly damaging Het
Plxna2 T C 1: 194,431,724 (GRCm39) V571A possibly damaging Het
Pnma2 A G 14: 67,153,371 (GRCm39) probably benign Het
Rnf123 T A 9: 107,929,467 (GRCm39) E1234D probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,103,382 (GRCm39) probably benign Het
Slc22a23 T C 13: 34,528,561 (GRCm39) S74G probably benign Het
Slc36a4 T C 9: 15,645,563 (GRCm39) I330T probably damaging Het
Snrk A T 9: 121,995,463 (GRCm39) D414V probably benign Het
Snrnp200 G A 2: 127,079,978 (GRCm39) probably null Het
Spata31d1b T C 13: 59,863,403 (GRCm39) S184P probably damaging Het
Tas2r140 A T 6: 133,032,241 (GRCm39) N172K probably benign Het
Tbc1d4 G T 14: 101,700,356 (GRCm39) Q858K probably damaging Het
Tex55 T G 16: 38,648,407 (GRCm39) D234A probably benign Het
Tial1 A G 7: 128,044,209 (GRCm39) C102R unknown Het
Ugt8a A T 3: 125,665,263 (GRCm39) D411E probably benign Het
Usp34 A G 11: 23,399,223 (GRCm39) D2404G Het
Vmn1r10 A C 6: 57,090,833 (GRCm39) I142L probably benign Het
Wdr97 A G 15: 76,240,367 (GRCm39) T352A Het
Xpo7 A T 14: 70,925,733 (GRCm39) D435E probably damaging Het
Zmym1 A G 4: 126,952,683 (GRCm39) S33P probably damaging Het
Other mutations in Pde3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Pde3a APN 6 141,405,464 (GRCm39) missense probably damaging 1.00
IGL01400:Pde3a APN 6 141,404,954 (GRCm39) missense probably benign 0.02
IGL01752:Pde3a APN 6 141,433,339 (GRCm39) splice site probably benign
IGL01819:Pde3a APN 6 141,433,263 (GRCm39) missense probably damaging 1.00
IGL02014:Pde3a APN 6 141,404,870 (GRCm39) missense probably null 1.00
IGL02119:Pde3a APN 6 141,405,529 (GRCm39) missense probably damaging 0.97
IGL02465:Pde3a APN 6 141,195,401 (GRCm39) missense possibly damaging 0.53
IGL02677:Pde3a APN 6 141,350,898 (GRCm39) splice site probably benign
IGL02961:Pde3a APN 6 141,405,426 (GRCm39) nonsense probably null
IGL03034:Pde3a APN 6 141,438,126 (GRCm39) splice site probably benign
IGL03142:Pde3a APN 6 141,438,025 (GRCm39) missense probably benign 0.01
PIT4305001:Pde3a UTSW 6 141,438,036 (GRCm39) missense probably benign 0.04
R0412:Pde3a UTSW 6 141,444,410 (GRCm39) missense probably damaging 1.00
R0517:Pde3a UTSW 6 141,444,383 (GRCm39) nonsense probably null
R0573:Pde3a UTSW 6 141,437,957 (GRCm39) missense probably damaging 1.00
R0621:Pde3a UTSW 6 141,195,725 (GRCm39) missense probably damaging 1.00
R0781:Pde3a UTSW 6 141,405,042 (GRCm39) splice site probably benign
R1065:Pde3a UTSW 6 141,422,458 (GRCm39) splice site probably benign
R1110:Pde3a UTSW 6 141,405,042 (GRCm39) splice site probably benign
R1462:Pde3a UTSW 6 141,405,560 (GRCm39) missense probably benign 0.05
R1462:Pde3a UTSW 6 141,405,560 (GRCm39) missense probably benign 0.05
R1470:Pde3a UTSW 6 141,411,932 (GRCm39) missense probably benign 0.41
R1470:Pde3a UTSW 6 141,411,932 (GRCm39) missense probably benign 0.41
R1480:Pde3a UTSW 6 141,433,300 (GRCm39) missense probably benign 0.17
R1559:Pde3a UTSW 6 141,404,824 (GRCm39) missense probably damaging 1.00
R1862:Pde3a UTSW 6 141,433,239 (GRCm39) missense probably damaging 1.00
R1862:Pde3a UTSW 6 141,196,079 (GRCm39) missense probably damaging 1.00
R1902:Pde3a UTSW 6 141,444,496 (GRCm39) missense probably benign
R1909:Pde3a UTSW 6 141,195,965 (GRCm39) missense probably benign 0.00
R2048:Pde3a UTSW 6 141,434,732 (GRCm39) splice site probably benign
R2144:Pde3a UTSW 6 141,435,837 (GRCm39) missense probably benign 0.40
R2155:Pde3a UTSW 6 141,429,640 (GRCm39) missense possibly damaging 0.70
R2208:Pde3a UTSW 6 141,196,073 (GRCm39) missense probably damaging 0.97
R2405:Pde3a UTSW 6 141,426,968 (GRCm39) missense probably damaging 1.00
R4592:Pde3a UTSW 6 141,404,942 (GRCm39) missense probably benign 0.13
R4677:Pde3a UTSW 6 141,411,865 (GRCm39) missense probably benign 0.02
R4803:Pde3a UTSW 6 141,404,812 (GRCm39) missense probably damaging 1.00
R4887:Pde3a UTSW 6 141,416,668 (GRCm39) missense possibly damaging 0.94
R4999:Pde3a UTSW 6 141,195,751 (GRCm39) missense probably benign 0.00
R5055:Pde3a UTSW 6 141,433,682 (GRCm39) nonsense probably null
R5181:Pde3a UTSW 6 141,426,981 (GRCm39) critical splice donor site probably null
R5640:Pde3a UTSW 6 141,429,641 (GRCm39) missense probably damaging 0.99
R5694:Pde3a UTSW 6 141,196,228 (GRCm39) missense possibly damaging 0.48
R6176:Pde3a UTSW 6 141,444,615 (GRCm39) missense possibly damaging 0.96
R6394:Pde3a UTSW 6 141,433,237 (GRCm39) missense probably damaging 1.00
R6692:Pde3a UTSW 6 141,425,072 (GRCm39) missense probably damaging 1.00
R6968:Pde3a UTSW 6 141,433,658 (GRCm39) missense probably damaging 1.00
R7137:Pde3a UTSW 6 141,444,472 (GRCm39) missense probably benign 0.26
R7163:Pde3a UTSW 6 141,433,270 (GRCm39) missense probably damaging 1.00
R7677:Pde3a UTSW 6 141,195,983 (GRCm39) missense probably damaging 1.00
R7754:Pde3a UTSW 6 141,404,975 (GRCm39) missense probably benign 0.32
R8037:Pde3a UTSW 6 141,429,650 (GRCm39) missense possibly damaging 0.82
R8123:Pde3a UTSW 6 141,411,917 (GRCm39) missense probably benign 0.00
R8206:Pde3a UTSW 6 141,433,611 (GRCm39) missense probably damaging 1.00
R8262:Pde3a UTSW 6 141,433,527 (GRCm39) missense possibly damaging 0.89
R8376:Pde3a UTSW 6 141,426,947 (GRCm39) missense possibly damaging 0.50
R8893:Pde3a UTSW 6 141,405,522 (GRCm39) missense probably damaging 1.00
R9037:Pde3a UTSW 6 141,416,832 (GRCm39) missense probably damaging 1.00
R9158:Pde3a UTSW 6 141,195,614 (GRCm39) missense probably benign
R9222:Pde3a UTSW 6 141,437,904 (GRCm39) missense probably damaging 1.00
R9318:Pde3a UTSW 6 141,425,202 (GRCm39) missense probably benign 0.01
X0053:Pde3a UTSW 6 141,429,695 (GRCm39) splice site probably null
X0062:Pde3a UTSW 6 141,195,710 (GRCm39) missense probably damaging 1.00
Z1177:Pde3a UTSW 6 141,196,195 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GCCAGGAGAATGTTGACTTGC -3'
(R):5'- ACATTTCTCTAACTCTACGGCAGG -3'

Sequencing Primer
(F):5'- CAGGAGAATGTTGACTTGCCTCAC -3'
(R):5'- TTTCTCTAACTCTACGGCAGGAAACC -3'
Posted On 2022-04-18