Mutagenetix > Incidental Mutation

Incidental Mutation 'R9385:Pde3a'

710258

Institutional Source

Beutler Lab

Gene Symbol

Pde3a

Ensembl Gene

ENSMUSG00000041741

Gene Name

phosphodiesterase 3A, cGMP inhibited

Synonyms

A930022O17Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.345) question?

Stock #

R9385 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141249269-141507448 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141492256 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1017 (D1017G)

Ref Sequence

ENSEMBL: ENSMUSP00000038749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043259]

AlphaFold

Q9Z0X4

Predicted Effect

probably benign
Transcript: ENSMUST00000043259
AA Change: D1017G

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741
AA Change: D1017G

Domain	Start	End	E-Value	Type
low complexity region	29	43	N/A	INTRINSIC
transmembrane domain	60	82	N/A	INTRINSIC
low complexity region	93	102	N/A	INTRINSIC
low complexity region	103	121	N/A	INTRINSIC
transmembrane domain	126	148	N/A	INTRINSIC
transmembrane domain	155	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
transmembrane domain	230	252	N/A	INTRINSIC
low complexity region	419	445	N/A	INTRINSIC
low complexity region	520	544	N/A	INTRINSIC
HDc	749	964	3.76e-4	SMART
low complexity region	1028	1056	N/A	INTRINSIC
low complexity region	1114	1133	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,161,192	I554T	possibly damaging	Het
4930435E12Rik	T	G	16: 38,828,045	D234A	probably benign	Het
Adamts7	C	A	9: 90,195,205	C1308*	probably null	Het
Ank2	A	G	3: 126,959,717	V305A	probably benign	Het
Apob	A	G	12: 8,006,399	N1627S	possibly damaging	Het
Atp10a	A	T	7: 58,828,139	Q1310L	probably benign	Het
Atp8b4	A	T	2: 126,480,631	Y29*	probably null	Het
Card11	C	A	5: 140,885,521	R742S	probably benign	Het
Ccdc88a	A	G	11: 29,455,422	D365G	probably benign	Het
Ccdc88b	G	A	19: 6,856,165	R211W	probably benign	Het
Cda	T	G	4: 138,351,287	I55L	probably benign	Het
Cdkl3	A	C	11: 52,035,952	E577D	probably benign	Het
Cel	T	C	2: 28,560,575	D146G	probably damaging	Het
Cmya5	A	G	13: 93,094,372	S1403P	probably damaging	Het
Cntn2	G	A	1: 132,528,174	S202L	probably damaging	Het
Col15a1	C	T	4: 47,300,473	Q1045*	probably null	Het
Csmd1	T	C	8: 15,984,756	T2472A	probably benign	Het
Ctbp2	G	A	7: 132,999,340	R22C	probably benign	Het
Ddit4	A	G	10: 59,951,356	S53P	probably damaging	Het
Ddx52	G	T	11: 83,952,270	C365F	probably damaging	Het
Dnhd1	C	A	7: 105,712,765	L3677I	probably damaging	Het
Dscam	T	C	16: 97,039,003	T135A	probably benign	Het
Espl1	T	A	15: 102,298,750	D216E	probably damaging	Het
Fsip2	T	A	2: 82,989,449	D5175E	possibly damaging	Het
Fxr1	A	G	3: 34,019,971		probably benign	Het
Fyb	A	G	15: 6,634,816	D460G	probably benign	Het
Gm3264	T	C	14: 4,871,178	I8T	possibly damaging	Het
Gm35339	A	G	15: 76,356,167	T352A		Het
Gsdmc	A	T	15: 63,803,637	Y110N	possibly damaging	Het
H13	A	G	2: 152,695,493	N286S	probably benign	Het
Heatr1	A	G	13: 12,406,542	D441G	probably damaging	Het
Hist1h2aa	A	T	13: 23,934,696	I79F	probably damaging	Het
Hps6	A	G	19: 46,005,910	D762G	probably damaging	Het
Hyou1	C	A	9: 44,381,515	Q141K	probably benign	Het
Lpin3	T	C	2: 160,897,073	I267T	probably benign	Het
Mdc1	A	G	17: 35,850,504	K770E	probably benign	Het
Mlh3	C	T	12: 85,269,370	R14H	probably damaging	Het
Nfxl1	C	A	5: 72,537,407	V478F	probably benign	Het
Nhlrc3	A	G	3: 53,453,594	W247R	probably damaging	Het
Nlrc3	C	T	16: 3,964,012	G527D	probably damaging	Het
Nop9	A	G	14: 55,751,127	E342G	probably benign	Het
Ntn1	C	A	11: 68,385,187	G312C	probably damaging	Het
Olfr288	C	T	15: 98,187,605	S64N	probably damaging	Het
Olfr474	T	A	7: 107,955,573	*311K	probably null	Het
Opcml	T	C	9: 28,675,163	V59A	possibly damaging	Het
Opn1sw	T	G	6: 29,379,426	Y193S	probably damaging	Het
Pabpc4l	A	T	3: 46,446,702	V169E	probably damaging	Het
Plagl2	C	T	2: 153,232,318	C221Y	probably damaging	Het
Plppr4	G	T	3: 117,322,728	N493K	possibly damaging	Het
Plxna2	T	C	1: 194,749,416	V571A	possibly damaging	Het
Pnma2	A	G	14: 66,915,922		probably benign	Het
Rnf123	T	A	9: 108,052,268	E1234D	probably benign	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Het
Slc22a23	T	C	13: 34,344,578	S74G	probably benign	Het
Slc36a4	T	C	9: 15,734,267	I330T	probably damaging	Het
Snrk	A	T	9: 122,166,397	D414V	probably benign	Het
Snrnp200	G	A	2: 127,238,058		probably null	Het
Spata31d1b	T	C	13: 59,715,589	S184P	probably damaging	Het
Tas2r140	A	T	6: 133,055,278	N172K	probably benign	Het
Tbc1d4	G	T	14: 101,462,920	Q858K	probably damaging	Het
Tial1	A	G	7: 128,442,485	C102R	unknown	Het
Ugt8a	A	T	3: 125,871,614	D411E	probably benign	Het
Usp34	A	G	11: 23,449,223	D2404G		Het
Vmn1r10	A	C	6: 57,113,848	I142L	probably benign	Het
Wdr66	T	C	5: 123,288,815	L919S	probably damaging	Het
Xpo7	A	T	14: 70,688,293	D435E	probably damaging	Het
Zmym1	A	G	4: 127,058,890	S33P	probably damaging	Het

Other mutations in Pde3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01388:Pde3a	APN	6	141459738	missense	probably damaging	1.00
IGL01400:Pde3a	APN	6	141459228	missense	probably benign	0.02
IGL01752:Pde3a	APN	6	141487613	splice site	probably benign
IGL01819:Pde3a	APN	6	141487537	missense	probably damaging	1.00
IGL02014:Pde3a	APN	6	141459144	missense	probably null	1.00
IGL02119:Pde3a	APN	6	141459803	missense	probably damaging	0.97
IGL02465:Pde3a	APN	6	141249675	missense	possibly damaging	0.53
IGL02677:Pde3a	APN	6	141405172	splice site	probably benign
IGL02961:Pde3a	APN	6	141459700	nonsense	probably null
IGL03034:Pde3a	APN	6	141492400	splice site	probably benign
IGL03142:Pde3a	APN	6	141492299	missense	probably benign	0.01
PIT4305001:Pde3a	UTSW	6	141492310	missense	probably benign	0.04
R0412:Pde3a	UTSW	6	141498684	missense	probably damaging	1.00
R0517:Pde3a	UTSW	6	141498657	nonsense	probably null
R0573:Pde3a	UTSW	6	141492231	missense	probably damaging	1.00
R0621:Pde3a	UTSW	6	141249999	missense	probably damaging	1.00
R0781:Pde3a	UTSW	6	141459316	splice site	probably benign
R1065:Pde3a	UTSW	6	141476732	splice site	probably benign
R1110:Pde3a	UTSW	6	141459316	splice site	probably benign
R1462:Pde3a	UTSW	6	141459834	missense	probably benign	0.05
R1462:Pde3a	UTSW	6	141459834	missense	probably benign	0.05
R1470:Pde3a	UTSW	6	141466206	missense	probably benign	0.41
R1470:Pde3a	UTSW	6	141466206	missense	probably benign	0.41
R1480:Pde3a	UTSW	6	141487574	missense	probably benign	0.17
R1559:Pde3a	UTSW	6	141459098	missense	probably damaging	1.00
R1862:Pde3a	UTSW	6	141250353	missense	probably damaging	1.00
R1862:Pde3a	UTSW	6	141487513	missense	probably damaging	1.00
R1902:Pde3a	UTSW	6	141498770	missense	probably benign
R1909:Pde3a	UTSW	6	141250239	missense	probably benign	0.00
R2048:Pde3a	UTSW	6	141489006	splice site	probably benign
R2144:Pde3a	UTSW	6	141490111	missense	probably benign	0.40
R2155:Pde3a	UTSW	6	141483914	missense	possibly damaging	0.70
R2208:Pde3a	UTSW	6	141250347	missense	probably damaging	0.97
R2405:Pde3a	UTSW	6	141481242	missense	probably damaging	1.00
R4592:Pde3a	UTSW	6	141459216	missense	probably benign	0.13
R4677:Pde3a	UTSW	6	141466139	missense	probably benign	0.02
R4803:Pde3a	UTSW	6	141459086	missense	probably damaging	1.00
R4887:Pde3a	UTSW	6	141470942	missense	possibly damaging	0.94
R4999:Pde3a	UTSW	6	141250025	missense	probably benign	0.00
R5055:Pde3a	UTSW	6	141487956	nonsense	probably null
R5181:Pde3a	UTSW	6	141481255	critical splice donor site	probably null
R5640:Pde3a	UTSW	6	141483915	missense	probably damaging	0.99
R5694:Pde3a	UTSW	6	141250502	missense	possibly damaging	0.48
R6176:Pde3a	UTSW	6	141498889	missense	possibly damaging	0.96
R6394:Pde3a	UTSW	6	141487511	missense	probably damaging	1.00
R6692:Pde3a	UTSW	6	141479346	missense	probably damaging	1.00
R6968:Pde3a	UTSW	6	141487932	missense	probably damaging	1.00
R7137:Pde3a	UTSW	6	141498746	missense	probably benign	0.26
R7163:Pde3a	UTSW	6	141487544	missense	probably damaging	1.00
R7677:Pde3a	UTSW	6	141250257	missense	probably damaging	1.00
R7754:Pde3a	UTSW	6	141459249	missense	probably benign	0.32
R8037:Pde3a	UTSW	6	141483924	missense	possibly damaging	0.82
R8123:Pde3a	UTSW	6	141466191	missense	probably benign	0.00
R8206:Pde3a	UTSW	6	141487885	missense	probably damaging	1.00
R8262:Pde3a	UTSW	6	141487801	missense	possibly damaging	0.89
R8376:Pde3a	UTSW	6	141481221	missense	possibly damaging	0.50
R8893:Pde3a	UTSW	6	141459796	missense	probably damaging	1.00
R9037:Pde3a	UTSW	6	141471106	missense	probably damaging	1.00
R9158:Pde3a	UTSW	6	141249888	missense	probably benign
R9222:Pde3a	UTSW	6	141492178	missense	probably damaging	1.00
R9318:Pde3a	UTSW	6	141479476	missense	probably benign	0.01
X0053:Pde3a	UTSW	6	141483969	splice site	probably null
X0062:Pde3a	UTSW	6	141249984	missense	probably damaging	1.00
Z1177:Pde3a	UTSW	6	141250469	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- GCCAGGAGAATGTTGACTTGC -3'
(R):5'- ACATTTCTCTAACTCTACGGCAGG -3'

Sequencing Primer
(F):5'- CAGGAGAATGTTGACTTGCCTCAC -3'
(R):5'- TTTCTCTAACTCTACGGCAGGAAACC -3'

Posted On

2022-04-18