Incidental Mutation 'R9385:Olfr474'
ID 710261
Institutional Source Beutler Lab
Gene Symbol Olfr474
Ensembl Gene ENSMUSG00000094197
Gene Name olfactory receptor 474
Synonyms GA_x6K02T2PBJ9-10283869-10284801, MOR204-20
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R9385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 107954643-107955575 bp(+) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) T to A at 107955573 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Lysine at position 311 (*311K)
Ref Sequence ENSEMBL: ENSMUSP00000055931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054434]
AlphaFold Q8VFC9
Predicted Effect probably null
Transcript: ENSMUST00000054434
AA Change: *311K
SMART Domains Protein: ENSMUSP00000055931
Gene: ENSMUSG00000094197
AA Change: *311K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.1e-39 PFAM
Pfam:7tm_1 41 290 9.4e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,161,192 I554T possibly damaging Het
4930435E12Rik T G 16: 38,828,045 D234A probably benign Het
Adamts7 C A 9: 90,195,205 C1308* probably null Het
Ank2 A G 3: 126,959,717 V305A probably benign Het
Apob A G 12: 8,006,399 N1627S possibly damaging Het
Atp10a A T 7: 58,828,139 Q1310L probably benign Het
Atp8b4 A T 2: 126,480,631 Y29* probably null Het
Card11 C A 5: 140,885,521 R742S probably benign Het
Ccdc88a A G 11: 29,455,422 D365G probably benign Het
Ccdc88b G A 19: 6,856,165 R211W probably benign Het
Cda T G 4: 138,351,287 I55L probably benign Het
Cdkl3 A C 11: 52,035,952 E577D probably benign Het
Cel T C 2: 28,560,575 D146G probably damaging Het
Cmya5 A G 13: 93,094,372 S1403P probably damaging Het
Cntn2 G A 1: 132,528,174 S202L probably damaging Het
Col15a1 C T 4: 47,300,473 Q1045* probably null Het
Csmd1 T C 8: 15,984,756 T2472A probably benign Het
Ctbp2 G A 7: 132,999,340 R22C probably benign Het
Ddit4 A G 10: 59,951,356 S53P probably damaging Het
Ddx52 G T 11: 83,952,270 C365F probably damaging Het
Dnhd1 C A 7: 105,712,765 L3677I probably damaging Het
Dscam T C 16: 97,039,003 T135A probably benign Het
Espl1 T A 15: 102,298,750 D216E probably damaging Het
Fsip2 T A 2: 82,989,449 D5175E possibly damaging Het
Fxr1 A G 3: 34,019,971 probably benign Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gm3264 T C 14: 4,871,178 I8T possibly damaging Het
Gm35339 A G 15: 76,356,167 T352A Het
Gsdmc A T 15: 63,803,637 Y110N possibly damaging Het
H13 A G 2: 152,695,493 N286S probably benign Het
Heatr1 A G 13: 12,406,542 D441G probably damaging Het
Hist1h2aa A T 13: 23,934,696 I79F probably damaging Het
Hps6 A G 19: 46,005,910 D762G probably damaging Het
Hyou1 C A 9: 44,381,515 Q141K probably benign Het
Lpin3 T C 2: 160,897,073 I267T probably benign Het
Mdc1 A G 17: 35,850,504 K770E probably benign Het
Mlh3 C T 12: 85,269,370 R14H probably damaging Het
Nfxl1 C A 5: 72,537,407 V478F probably benign Het
Nhlrc3 A G 3: 53,453,594 W247R probably damaging Het
Nlrc3 C T 16: 3,964,012 G527D probably damaging Het
Nop9 A G 14: 55,751,127 E342G probably benign Het
Ntn1 C A 11: 68,385,187 G312C probably damaging Het
Olfr288 C T 15: 98,187,605 S64N probably damaging Het
Opcml T C 9: 28,675,163 V59A possibly damaging Het
Opn1sw T G 6: 29,379,426 Y193S probably damaging Het
Pabpc4l A T 3: 46,446,702 V169E probably damaging Het
Pde3a A G 6: 141,492,256 D1017G probably benign Het
Plagl2 C T 2: 153,232,318 C221Y probably damaging Het
Plppr4 G T 3: 117,322,728 N493K possibly damaging Het
Plxna2 T C 1: 194,749,416 V571A possibly damaging Het
Pnma2 A G 14: 66,915,922 probably benign Het
Rnf123 T A 9: 108,052,268 E1234D probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc22a23 T C 13: 34,344,578 S74G probably benign Het
Slc36a4 T C 9: 15,734,267 I330T probably damaging Het
Snrk A T 9: 122,166,397 D414V probably benign Het
Snrnp200 G A 2: 127,238,058 probably null Het
Spata31d1b T C 13: 59,715,589 S184P probably damaging Het
Tas2r140 A T 6: 133,055,278 N172K probably benign Het
Tbc1d4 G T 14: 101,462,920 Q858K probably damaging Het
Tial1 A G 7: 128,442,485 C102R unknown Het
Ugt8a A T 3: 125,871,614 D411E probably benign Het
Usp34 A G 11: 23,449,223 D2404G Het
Vmn1r10 A C 6: 57,113,848 I142L probably benign Het
Wdr66 T C 5: 123,288,815 L919S probably damaging Het
Xpo7 A T 14: 70,688,293 D435E probably damaging Het
Zmym1 A G 4: 127,058,890 S33P probably damaging Het
Other mutations in Olfr474
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Olfr474 APN 7 107955373 missense possibly damaging 0.48
IGL01794:Olfr474 APN 7 107955295 missense probably damaging 1.00
IGL02007:Olfr474 APN 7 107954746 missense probably damaging 1.00
IGL02213:Olfr474 APN 7 107955304 missense probably damaging 1.00
IGL02529:Olfr474 APN 7 107955216 missense possibly damaging 0.86
IGL02814:Olfr474 APN 7 107954770 missense probably benign 0.00
IGL03242:Olfr474 APN 7 107955481 missense possibly damaging 0.90
R0331:Olfr474 UTSW 7 107954870 missense probably benign
R0409:Olfr474 UTSW 7 107955226 missense probably benign 0.01
R0433:Olfr474 UTSW 7 107955262 missense probably damaging 0.98
R1227:Olfr474 UTSW 7 107955052 missense probably damaging 1.00
R2108:Olfr474 UTSW 7 107955502 missense probably benign 0.00
R2256:Olfr474 UTSW 7 107955037 missense probably damaging 1.00
R5229:Olfr474 UTSW 7 107955169 missense probably damaging 1.00
R5454:Olfr474 UTSW 7 107954889 missense probably benign 0.09
R5834:Olfr474 UTSW 7 107954906 missense probably benign 0.01
R6002:Olfr474 UTSW 7 107955169 missense probably damaging 1.00
R6046:Olfr474 UTSW 7 107954794 missense probably benign
R8214:Olfr474 UTSW 7 107954967 missense probably benign 0.00
R9210:Olfr474 UTSW 7 107954810 missense probably benign 0.08
R9212:Olfr474 UTSW 7 107954810 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACTGATGGATGCCACAAGG -3'
(R):5'- TTCATGTCTTCGGGAAGTCC -3'

Sequencing Primer
(F):5'- GCAGTCACTCTCTACTATGGGAC -3'
(R):5'- GCATCTTGTGATAGCTACTC -3'
Posted On 2022-04-18