Incidental Mutation 'R9385:Tial1'
ID 710262
Institutional Source Beutler Lab
Gene Symbol Tial1
Ensembl Gene ENSMUSG00000030846
Gene Name Tia1 cytotoxic granule-associated RNA binding protein-like 1
Synonyms mTIAR, 5330433G13Rik, TIAR
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock # R9385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 128439777-128461717 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128442485 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 102 (C102R)
Ref Sequence ENSEMBL: ENSMUSP00000145770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033135] [ENSMUST00000106226] [ENSMUST00000106228] [ENSMUST00000123666] [ENSMUST00000133444] [ENSMUST00000141126] [ENSMUST00000165023] [ENSMUST00000205278] [ENSMUST00000205835]
AlphaFold P70318
Predicted Effect probably benign
Transcript: ENSMUST00000033135
SMART Domains Protein: ENSMUSP00000033135
Gene: ENSMUSG00000030846

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
RRM 98 171 2.76e-26 SMART
RRM 206 273 1.19e-16 SMART
low complexity region 343 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106226
SMART Domains Protein: ENSMUSP00000101833
Gene: ENSMUSG00000030846

DomainStartEndE-ValueType
RRM 10 98 7.41e-18 SMART
RRM 115 188 2.76e-26 SMART
RRM 223 290 1.19e-16 SMART
low complexity region 360 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106228
SMART Domains Protein: ENSMUSP00000101835
Gene: ENSMUSG00000030846

DomainStartEndE-ValueType
Pfam:RRM_1 11 50 1.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123666
SMART Domains Protein: ENSMUSP00000116921
Gene: ENSMUSG00000030846

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
Pfam:RRM_1 99 132 1.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133089
Predicted Effect probably benign
Transcript: ENSMUST00000133444
Predicted Effect probably benign
Transcript: ENSMUST00000141126
Predicted Effect probably benign
Transcript: ENSMUST00000165023
SMART Domains Protein: ENSMUSP00000126458
Gene: ENSMUSG00000030846

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
RRM 98 171 2.76e-26 SMART
RRM 206 273 1.19e-16 SMART
low complexity region 343 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205278
Predicted Effect unknown
Transcript: ENSMUST00000205835
AA Change: C102R
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RNA-binding proteins, has three RNA recognition motifs (RRMs), and binds adenine and uridine-rich elements in mRNA and pre-mRNAs of a wide range of genes. It regulates various activities including translational control, splicing and apoptosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The different isoforms have been show to function differently with respect to post-transcriptional silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit partial embryonic lethality and reduced postnatal survival, reduced embryonic and postnatal body weight, and male and female sterility. Infertility is owed to a substantial decrease in the survival of primordial germ cells atthe genital ridge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,161,192 I554T possibly damaging Het
4930435E12Rik T G 16: 38,828,045 D234A probably benign Het
Adamts7 C A 9: 90,195,205 C1308* probably null Het
Ank2 A G 3: 126,959,717 V305A probably benign Het
Apob A G 12: 8,006,399 N1627S possibly damaging Het
Atp10a A T 7: 58,828,139 Q1310L probably benign Het
Atp8b4 A T 2: 126,480,631 Y29* probably null Het
Card11 C A 5: 140,885,521 R742S probably benign Het
Ccdc88a A G 11: 29,455,422 D365G probably benign Het
Ccdc88b G A 19: 6,856,165 R211W probably benign Het
Cda T G 4: 138,351,287 I55L probably benign Het
Cdkl3 A C 11: 52,035,952 E577D probably benign Het
Cel T C 2: 28,560,575 D146G probably damaging Het
Cmya5 A G 13: 93,094,372 S1403P probably damaging Het
Cntn2 G A 1: 132,528,174 S202L probably damaging Het
Col15a1 C T 4: 47,300,473 Q1045* probably null Het
Csmd1 T C 8: 15,984,756 T2472A probably benign Het
Ctbp2 G A 7: 132,999,340 R22C probably benign Het
Ddit4 A G 10: 59,951,356 S53P probably damaging Het
Ddx52 G T 11: 83,952,270 C365F probably damaging Het
Dnhd1 C A 7: 105,712,765 L3677I probably damaging Het
Dscam T C 16: 97,039,003 T135A probably benign Het
Espl1 T A 15: 102,298,750 D216E probably damaging Het
Fsip2 T A 2: 82,989,449 D5175E possibly damaging Het
Fxr1 A G 3: 34,019,971 probably benign Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gm3264 T C 14: 4,871,178 I8T possibly damaging Het
Gm35339 A G 15: 76,356,167 T352A Het
Gsdmc A T 15: 63,803,637 Y110N possibly damaging Het
H13 A G 2: 152,695,493 N286S probably benign Het
Heatr1 A G 13: 12,406,542 D441G probably damaging Het
Hist1h2aa A T 13: 23,934,696 I79F probably damaging Het
Hps6 A G 19: 46,005,910 D762G probably damaging Het
Hyou1 C A 9: 44,381,515 Q141K probably benign Het
Lpin3 T C 2: 160,897,073 I267T probably benign Het
Mdc1 A G 17: 35,850,504 K770E probably benign Het
Mlh3 C T 12: 85,269,370 R14H probably damaging Het
Nfxl1 C A 5: 72,537,407 V478F probably benign Het
Nhlrc3 A G 3: 53,453,594 W247R probably damaging Het
Nlrc3 C T 16: 3,964,012 G527D probably damaging Het
Nop9 A G 14: 55,751,127 E342G probably benign Het
Ntn1 C A 11: 68,385,187 G312C probably damaging Het
Olfr288 C T 15: 98,187,605 S64N probably damaging Het
Olfr474 T A 7: 107,955,573 *311K probably null Het
Opcml T C 9: 28,675,163 V59A possibly damaging Het
Opn1sw T G 6: 29,379,426 Y193S probably damaging Het
Pabpc4l A T 3: 46,446,702 V169E probably damaging Het
Pde3a A G 6: 141,492,256 D1017G probably benign Het
Plagl2 C T 2: 153,232,318 C221Y probably damaging Het
Plppr4 G T 3: 117,322,728 N493K possibly damaging Het
Plxna2 T C 1: 194,749,416 V571A possibly damaging Het
Pnma2 A G 14: 66,915,922 probably benign Het
Rnf123 T A 9: 108,052,268 E1234D probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc22a23 T C 13: 34,344,578 S74G probably benign Het
Slc36a4 T C 9: 15,734,267 I330T probably damaging Het
Snrk A T 9: 122,166,397 D414V probably benign Het
Snrnp200 G A 2: 127,238,058 probably null Het
Spata31d1b T C 13: 59,715,589 S184P probably damaging Het
Tas2r140 A T 6: 133,055,278 N172K probably benign Het
Tbc1d4 G T 14: 101,462,920 Q858K probably damaging Het
Ugt8a A T 3: 125,871,614 D411E probably benign Het
Usp34 A G 11: 23,449,223 D2404G Het
Vmn1r10 A C 6: 57,113,848 I142L probably benign Het
Wdr66 T C 5: 123,288,815 L919S probably damaging Het
Xpo7 A T 14: 70,688,293 D435E probably damaging Het
Zmym1 A G 4: 127,058,890 S33P probably damaging Het
Other mutations in Tial1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Tial1 APN 7 128448345 missense probably damaging 1.00
IGL02623:Tial1 APN 7 128443883 missense probably benign 0.12
IGL02936:Tial1 APN 7 128442663 splice site probably benign
Neoblimp UTSW 7 128448691 missense possibly damaging 0.94
R0798:Tial1 UTSW 7 128443878 missense probably benign 0.04
R1583:Tial1 UTSW 7 128443910 missense probably damaging 1.00
R1913:Tial1 UTSW 7 128444659 missense probably damaging 1.00
R4863:Tial1 UTSW 7 128455028 missense probably damaging 1.00
R5026:Tial1 UTSW 7 128448396 missense probably damaging 0.97
R5039:Tial1 UTSW 7 128443968 intron probably benign
R5629:Tial1 UTSW 7 128444697 missense probably damaging 0.97
R6697:Tial1 UTSW 7 128444869 missense possibly damaging 0.94
R8072:Tial1 UTSW 7 128442470 missense unknown
R8178:Tial1 UTSW 7 128444890 missense probably benign 0.01
R8937:Tial1 UTSW 7 128454991 missense probably damaging 1.00
R9162:Tial1 UTSW 7 128448691 missense possibly damaging 0.94
Z1177:Tial1 UTSW 7 128442639 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATCGAAGTGTATTACCCATTTCTCC -3'
(R):5'- AAGTCAATCCCCTTCTGCTG -3'

Sequencing Primer
(F):5'- TCACCAAGCAAAGCTGTG -3'
(R):5'- CCCTTCTGCTGCTTGGATGG -3'
Posted On 2022-04-18