Incidental Mutation 'R9385:Hyou1'
ID 710267
Institutional Source Beutler Lab
Gene Symbol Hyou1
Ensembl Gene ENSMUSG00000032115
Gene Name hypoxia up-regulated 1
Synonyms Grp170, Cab140, Orp150, 140 kDa, CBP-140
Accession Numbers

Genbank: NM_021395; MGI: 108030

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 44379490-44392369 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 44381515 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 141 (Q141K)
Ref Sequence ENSEMBL: ENSMUSP00000068594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066601] [ENSMUST00000159473] [ENSMUST00000160902] [ENSMUST00000161318] [ENSMUST00000162560] [ENSMUST00000217019]
AlphaFold Q9JKR6
Predicted Effect probably benign
Transcript: ENSMUST00000066601
AA Change: Q141K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000068594
Gene: ENSMUSG00000032115
AA Change: Q141K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 669 1.3e-101 PFAM
Pfam:HSP70 690 814 2.1e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159473
AA Change: Q90K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124177
Gene: ENSMUSG00000032115
AA Change: Q90K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:HSP70 38 226 2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160902
AA Change: Q141K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125594
Gene: ENSMUSG00000032115
AA Change: Q141K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161318
AA Change: Q141K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123700
Gene: ENSMUSG00000032115
AA Change: Q141K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162560
AA Change: Q141K

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123749
Gene: ENSMUSG00000032115
AA Change: Q141K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 168 6.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217019
AA Change: Q141K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous mice display increased susceptibility to induced neuronal cell death. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,161,192 I554T possibly damaging Het
4930435E12Rik T G 16: 38,828,045 D234A probably benign Het
Adamts7 C A 9: 90,195,205 C1308* probably null Het
Ank2 A G 3: 126,959,717 V305A probably benign Het
Apob A G 12: 8,006,399 N1627S possibly damaging Het
Atp10a A T 7: 58,828,139 Q1310L probably benign Het
Atp8b4 A T 2: 126,480,631 Y29* probably null Het
Card11 C A 5: 140,885,521 R742S probably benign Het
Ccdc88a A G 11: 29,455,422 D365G probably benign Het
Ccdc88b G A 19: 6,856,165 R211W probably benign Het
Cda T G 4: 138,351,287 I55L probably benign Het
Cdkl3 A C 11: 52,035,952 E577D probably benign Het
Cel T C 2: 28,560,575 D146G probably damaging Het
Cmya5 A G 13: 93,094,372 S1403P probably damaging Het
Cntn2 G A 1: 132,528,174 S202L probably damaging Het
Col15a1 C T 4: 47,300,473 Q1045* probably null Het
Csmd1 T C 8: 15,984,756 T2472A probably benign Het
Ctbp2 G A 7: 132,999,340 R22C probably benign Het
Ddit4 A G 10: 59,951,356 S53P probably damaging Het
Ddx52 G T 11: 83,952,270 C365F probably damaging Het
Dnhd1 C A 7: 105,712,765 L3677I probably damaging Het
Dscam T C 16: 97,039,003 T135A probably benign Het
Espl1 T A 15: 102,298,750 D216E probably damaging Het
Fsip2 T A 2: 82,989,449 D5175E possibly damaging Het
Fxr1 A G 3: 34,019,971 probably benign Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gm3264 T C 14: 4,871,178 I8T possibly damaging Het
Gm35339 A G 15: 76,356,167 T352A Het
Gsdmc A T 15: 63,803,637 Y110N possibly damaging Het
H13 A G 2: 152,695,493 N286S probably benign Het
Heatr1 A G 13: 12,406,542 D441G probably damaging Het
Hist1h2aa A T 13: 23,934,696 I79F probably damaging Het
Hps6 A G 19: 46,005,910 D762G probably damaging Het
Lpin3 T C 2: 160,897,073 I267T probably benign Het
Mdc1 A G 17: 35,850,504 K770E probably benign Het
Mlh3 C T 12: 85,269,370 R14H probably damaging Het
Nfxl1 C A 5: 72,537,407 V478F probably benign Het
Nhlrc3 A G 3: 53,453,594 W247R probably damaging Het
Nlrc3 C T 16: 3,964,012 G527D probably damaging Het
Nop9 A G 14: 55,751,127 E342G probably benign Het
Ntn1 C A 11: 68,385,187 G312C probably damaging Het
Olfr288 C T 15: 98,187,605 S64N probably damaging Het
Olfr474 T A 7: 107,955,573 *311K probably null Het
Opcml T C 9: 28,675,163 V59A possibly damaging Het
Opn1sw T G 6: 29,379,426 Y193S probably damaging Het
Pabpc4l A T 3: 46,446,702 V169E probably damaging Het
Pde3a A G 6: 141,492,256 D1017G probably benign Het
Plagl2 C T 2: 153,232,318 C221Y probably damaging Het
Plppr4 G T 3: 117,322,728 N493K possibly damaging Het
Plxna2 T C 1: 194,749,416 V571A possibly damaging Het
Pnma2 A G 14: 66,915,922 probably benign Het
Rnf123 T A 9: 108,052,268 E1234D probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc22a23 T C 13: 34,344,578 S74G probably benign Het
Slc36a4 T C 9: 15,734,267 I330T probably damaging Het
Snrk A T 9: 122,166,397 D414V probably benign Het
Snrnp200 G A 2: 127,238,058 probably null Het
Spata31d1b T C 13: 59,715,589 S184P probably damaging Het
Tas2r140 A T 6: 133,055,278 N172K probably benign Het
Tbc1d4 G T 14: 101,462,920 Q858K probably damaging Het
Tial1 A G 7: 128,442,485 C102R unknown Het
Ugt8a A T 3: 125,871,614 D411E probably benign Het
Usp34 A G 11: 23,449,223 D2404G Het
Vmn1r10 A C 6: 57,113,848 I142L probably benign Het
Wdr66 T C 5: 123,288,815 L919S probably damaging Het
Xpo7 A T 14: 70,688,293 D435E probably damaging Het
Zmym1 A G 4: 127,058,890 S33P probably damaging Het
Other mutations in Hyou1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hyou1 APN 9 44385146 missense probably benign 0.02
IGL01660:Hyou1 APN 9 44381117 missense possibly damaging 0.75
IGL01677:Hyou1 APN 9 44382012 missense probably benign 0.21
IGL01903:Hyou1 APN 9 44381141 splice site probably benign
IGL02636:Hyou1 APN 9 44381410 critical splice donor site probably null
IGL02806:Hyou1 APN 9 44388883 nonsense probably null
IGL03401:Hyou1 APN 9 44384909 missense probably damaging 1.00
IGL03410:Hyou1 APN 9 44388058 missense probably benign
ANU74:Hyou1 UTSW 9 44381263 missense possibly damaging 0.79
D3080:Hyou1 UTSW 9 44384477 missense probably damaging 0.97
PIT4378001:Hyou1 UTSW 9 44390851 missense probably benign 0.26
R0408:Hyou1 UTSW 9 44384692 missense probably damaging 1.00
R0422:Hyou1 UTSW 9 44389242 missense probably damaging 1.00
R1116:Hyou1 UTSW 9 44384681 missense probably damaging 1.00
R1581:Hyou1 UTSW 9 44388870 missense probably damaging 1.00
R1640:Hyou1 UTSW 9 44389406 missense probably benign 0.02
R1803:Hyou1 UTSW 9 44384182 nonsense probably null
R2060:Hyou1 UTSW 9 44381552 missense probably benign 0.28
R2180:Hyou1 UTSW 9 44388019 missense probably benign 0.30
R2233:Hyou1 UTSW 9 44389091 missense probably benign 0.44
R2235:Hyou1 UTSW 9 44389091 missense probably benign 0.44
R3950:Hyou1 UTSW 9 44385227 missense probably damaging 1.00
R4198:Hyou1 UTSW 9 44388859 missense probably damaging 1.00
R4200:Hyou1 UTSW 9 44388859 missense probably damaging 1.00
R4363:Hyou1 UTSW 9 44380615 splice site probably null
R4393:Hyou1 UTSW 9 44381872 missense probably damaging 1.00
R4394:Hyou1 UTSW 9 44381872 missense probably damaging 1.00
R4812:Hyou1 UTSW 9 44387121 intron probably benign
R5239:Hyou1 UTSW 9 44385263 missense possibly damaging 0.96
R5648:Hyou1 UTSW 9 44385249 missense probably damaging 0.99
R5818:Hyou1 UTSW 9 44388926 critical splice donor site probably null
R5856:Hyou1 UTSW 9 44381344 missense probably damaging 1.00
R6431:Hyou1 UTSW 9 44382025 critical splice donor site probably null
R6594:Hyou1 UTSW 9 44389322 missense probably benign
R6596:Hyou1 UTSW 9 44387755 missense probably benign 0.00
R6613:Hyou1 UTSW 9 44382498 missense probably damaging 0.99
R6704:Hyou1 UTSW 9 44381134 critical splice donor site probably null
R6849:Hyou1 UTSW 9 44387264 missense probably damaging 0.99
R7494:Hyou1 UTSW 9 44389409 missense probably benign 0.04
R7632:Hyou1 UTSW 9 44381136 splice site probably null
R7711:Hyou1 UTSW 9 44384462 missense possibly damaging 0.91
R8064:Hyou1 UTSW 9 44385585 missense possibly damaging 0.80
R8287:Hyou1 UTSW 9 44388133 missense probably benign 0.26
R9352:Hyou1 UTSW 9 44389629 critical splice donor site probably null
X0027:Hyou1 UTSW 9 44390856 missense possibly damaging 0.89
Z1176:Hyou1 UTSW 9 44387742 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCCGTTTCCCAGAACATG -3'
(R):5'- GTACCACTGACTCTTACCGG -3'

Sequencing Primer
(F):5'- CCGTTTCCCAGAACATGAGCTAATTG -3'
(R):5'- ACCAAACATGTCTTCCGGTATGG -3'
Posted On 2022-04-18