Mutagenetix > Incidental Mutation

Incidental Mutation 'R9385:Adamts7'

710268

Institutional Source

Beutler Lab

Gene Symbol

Adamts7

Ensembl Gene

ENSMUSG00000032363

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 7

Synonyms

ADAM-TS7

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R9385 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

90163069-90208071 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 90195205 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 1308 (C1308*)

Ref Sequence

ENSEMBL: ENSMUSP00000115972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113059] [ENSMUST00000113060] [ENSMUST00000134996] [ENSMUST00000147250] [ENSMUST00000167122]

AlphaFold

Q68SA9

Predicted Effect

probably null
Transcript: ENSMUST00000113059
AA Change: C1409*

SMART Domains

Protein: ENSMUSP00000108682
Gene: ENSMUSG00000032363
AA Change: C1409*

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	34	174	1.1e-36	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.3e-16	PFAM
Pfam:Reprolysin_4	224	425	8.5e-9	PFAM
Pfam:Reprolysin	226	437	2.2e-27	PFAM
Pfam:Reprolysin_2	244	427	2.9e-12	PFAM
Pfam:Reprolysin_3	248	383	5.2e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	2.2e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
TSP1	929	978	1.45e-6	SMART
low complexity region	1011	1025	N/A	INTRINSIC
low complexity region	1211	1233	N/A	INTRINSIC
TSP1	1385	1435	2.4e-2	SMART
TSP1	1436	1493	1.8e-2	SMART
TSP1	1495	1542	4.82e-2	SMART
TSP1	1543	1600	1.39e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113060
AA Change: C1367*

SMART Domains

Protein: ENSMUSP00000108683
Gene: ENSMUSG00000032363
AA Change: C1367*

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	3.4e-28	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.6e-16	PFAM
Pfam:Reprolysin_4	224	425	8.2e-9	PFAM
Pfam:Reprolysin	226	437	6.4e-30	PFAM
Pfam:Reprolysin_2	244	427	4.6e-12	PFAM
Pfam:Reprolysin_3	248	383	8.1e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	1.5e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
low complexity region	969	983	N/A	INTRINSIC
low complexity region	1169	1191	N/A	INTRINSIC
TSP1	1343	1393	2.4e-2	SMART
TSP1	1394	1451	1.8e-2	SMART
TSP1	1453	1500	4.82e-2	SMART
TSP1	1501	1558	1.39e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000134996

SMART Domains

Protein: ENSMUSP00000119744
Gene: ENSMUSG00000032363

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	2.4e-29	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	412	1e-17	PFAM
Pfam:Reprolysin_4	224	426	5e-10	PFAM
Pfam:Reprolysin	226	437	3.7e-31	PFAM
Pfam:Reprolysin_2	244	427	3.2e-13	PFAM
Pfam:Reprolysin_3	248	383	6.3e-14	PFAM
Blast:ACR	439	505	7e-12	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000147250
AA Change: C1308*

SMART Domains

Protein: ENSMUSP00000115972
Gene: ENSMUSG00000032363
AA Change: C1308*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	2.7e-26	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.4e-14	PFAM
Pfam:Reprolysin_4	224	425	7e-7	PFAM
Pfam:Reprolysin	226	437	4.9e-28	PFAM
Pfam:Reprolysin_2	244	427	5e-10	PFAM
Pfam:Reprolysin_3	248	383	6.5e-11	PFAM
ACR	439	515	1.7e-5	SMART
TSP1	526	578	2.3e-15	SMART
Pfam:ADAM_spacer1	683	794	3.5e-34	PFAM
TSP1	807	863	6.9e-9	SMART
TSP1	866	908	1.2e-3	SMART
low complexity region	969	983	N/A	INTRINSIC
low complexity region	1169	1191	N/A	INTRINSIC
TSP1	1284	1334	1.2e-4	SMART
TSP1	1335	1392	8.7e-5	SMART
TSP1	1394	1441	2.3e-4	SMART
TSP1	1442	1499	6.5e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000167122
AA Change: C1409*

SMART Domains

Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363
AA Change: C1409*

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	1.4e-28	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	7.2e-17	PFAM
Pfam:Reprolysin_4	224	425	3.6e-9	PFAM
Pfam:Reprolysin	226	437	2.9e-30	PFAM
Pfam:Reprolysin_2	244	427	2.2e-12	PFAM
Pfam:Reprolysin_3	248	383	3.7e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	1.1e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
TSP1	929	978	1.45e-6	SMART
low complexity region	1011	1025	N/A	INTRINSIC
low complexity region	1211	1233	N/A	INTRINSIC
TSP1	1385	1435	2.4e-2	SMART
TSP1	1436	1493	1.8e-2	SMART
TSP1	1495	1542	4.82e-2	SMART
TSP1	1543	1600	1.39e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent enzyme that degrades cartilage oligomeric matrix protein. The deficiency of the encoded protein decreases atherosclerosis in genetically hyperlipidemic mice and in response to vascular injury. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show increased lung function parameters, reduced endothelial cell migration and proliferation, increased re-endothelialization and ameliorated neointima formation after carotid artery injury, and increased oval cell activation and biliary fibrosis after liver injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,161,192	I554T	possibly damaging	Het
4930435E12Rik	T	G	16: 38,828,045	D234A	probably benign	Het
Ank2	A	G	3: 126,959,717	V305A	probably benign	Het
Apob	A	G	12: 8,006,399	N1627S	possibly damaging	Het
Atp10a	A	T	7: 58,828,139	Q1310L	probably benign	Het
Atp8b4	A	T	2: 126,480,631	Y29*	probably null	Het
Card11	C	A	5: 140,885,521	R742S	probably benign	Het
Ccdc88a	A	G	11: 29,455,422	D365G	probably benign	Het
Ccdc88b	G	A	19: 6,856,165	R211W	probably benign	Het
Cda	T	G	4: 138,351,287	I55L	probably benign	Het
Cdkl3	A	C	11: 52,035,952	E577D	probably benign	Het
Cel	T	C	2: 28,560,575	D146G	probably damaging	Het
Cmya5	A	G	13: 93,094,372	S1403P	probably damaging	Het
Cntn2	G	A	1: 132,528,174	S202L	probably damaging	Het
Col15a1	C	T	4: 47,300,473	Q1045*	probably null	Het
Csmd1	T	C	8: 15,984,756	T2472A	probably benign	Het
Ctbp2	G	A	7: 132,999,340	R22C	probably benign	Het
Ddit4	A	G	10: 59,951,356	S53P	probably damaging	Het
Ddx52	G	T	11: 83,952,270	C365F	probably damaging	Het
Dnhd1	C	A	7: 105,712,765	L3677I	probably damaging	Het
Dscam	T	C	16: 97,039,003	T135A	probably benign	Het
Espl1	T	A	15: 102,298,750	D216E	probably damaging	Het
Fsip2	T	A	2: 82,989,449	D5175E	possibly damaging	Het
Fxr1	A	G	3: 34,019,971		probably benign	Het
Fyb	A	G	15: 6,634,816	D460G	probably benign	Het
Gm3264	T	C	14: 4,871,178	I8T	possibly damaging	Het
Gm35339	A	G	15: 76,356,167	T352A		Het
Gsdmc	A	T	15: 63,803,637	Y110N	possibly damaging	Het
H13	A	G	2: 152,695,493	N286S	probably benign	Het
Heatr1	A	G	13: 12,406,542	D441G	probably damaging	Het
Hist1h2aa	A	T	13: 23,934,696	I79F	probably damaging	Het
Hps6	A	G	19: 46,005,910	D762G	probably damaging	Het
Hyou1	C	A	9: 44,381,515	Q141K	probably benign	Het
Lpin3	T	C	2: 160,897,073	I267T	probably benign	Het
Mdc1	A	G	17: 35,850,504	K770E	probably benign	Het
Mlh3	C	T	12: 85,269,370	R14H	probably damaging	Het
Nfxl1	C	A	5: 72,537,407	V478F	probably benign	Het
Nhlrc3	A	G	3: 53,453,594	W247R	probably damaging	Het
Nlrc3	C	T	16: 3,964,012	G527D	probably damaging	Het
Nop9	A	G	14: 55,751,127	E342G	probably benign	Het
Ntn1	C	A	11: 68,385,187	G312C	probably damaging	Het
Olfr288	C	T	15: 98,187,605	S64N	probably damaging	Het
Olfr474	T	A	7: 107,955,573	*311K	probably null	Het
Opcml	T	C	9: 28,675,163	V59A	possibly damaging	Het
Opn1sw	T	G	6: 29,379,426	Y193S	probably damaging	Het
Pabpc4l	A	T	3: 46,446,702	V169E	probably damaging	Het
Pde3a	A	G	6: 141,492,256	D1017G	probably benign	Het
Plagl2	C	T	2: 153,232,318	C221Y	probably damaging	Het
Plppr4	G	T	3: 117,322,728	N493K	possibly damaging	Het
Plxna2	T	C	1: 194,749,416	V571A	possibly damaging	Het
Pnma2	A	G	14: 66,915,922		probably benign	Het
Rnf123	T	A	9: 108,052,268	E1234D	probably benign	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Het
Slc22a23	T	C	13: 34,344,578	S74G	probably benign	Het
Slc36a4	T	C	9: 15,734,267	I330T	probably damaging	Het
Snrk	A	T	9: 122,166,397	D414V	probably benign	Het
Snrnp200	G	A	2: 127,238,058		probably null	Het
Spata31d1b	T	C	13: 59,715,589	S184P	probably damaging	Het
Tas2r140	A	T	6: 133,055,278	N172K	probably benign	Het
Tbc1d4	G	T	14: 101,462,920	Q858K	probably damaging	Het
Tial1	A	G	7: 128,442,485	C102R	unknown	Het
Ugt8a	A	T	3: 125,871,614	D411E	probably benign	Het
Usp34	A	G	11: 23,449,223	D2404G		Het
Vmn1r10	A	C	6: 57,113,848	I142L	probably benign	Het
Wdr66	T	C	5: 123,288,815	L919S	probably damaging	Het
Xpo7	A	T	14: 70,688,293	D435E	probably damaging	Het
Zmym1	A	G	4: 127,058,890	S33P	probably damaging	Het

Other mutations in Adamts7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Adamts7	APN	9	90194249	missense	possibly damaging	0.71
IGL00673:Adamts7	APN	9	90193661	missense	possibly damaging	0.78
IGL00902:Adamts7	APN	9	90188794	critical splice donor site	probably null
IGL01303:Adamts7	APN	9	90171734	missense	possibly damaging	0.46
IGL01333:Adamts7	APN	9	90186979	missense	probably damaging	1.00
IGL01431:Adamts7	APN	9	90207785	missense	possibly damaging	0.89
IGL01595:Adamts7	APN	9	90193306	missense	probably benign	0.02
IGL02728:Adamts7	APN	9	90191827	splice site	probably benign
IGL02860:Adamts7	APN	9	90191862	missense	probably benign
IGL03237:Adamts7	APN	9	90188664	missense	probably damaging	1.00
PIT4495001:Adamts7	UTSW	9	90174622	missense	probably damaging	1.00
R0044:Adamts7	UTSW	9	90171588	missense	possibly damaging	0.58
R0078:Adamts7	UTSW	9	90179411	missense	probably damaging	1.00
R0107:Adamts7	UTSW	9	90180720	missense	possibly damaging	0.82
R0122:Adamts7	UTSW	9	90179421	missense	probably damaging	1.00
R0166:Adamts7	UTSW	9	90193692	missense	probably benign	0.00
R0517:Adamts7	UTSW	9	90199858	missense	probably benign	0.01
R1442:Adamts7	UTSW	9	90188770	missense	probably damaging	0.99
R1468:Adamts7	UTSW	9	90188798	splice site	probably benign
R1554:Adamts7	UTSW	9	90173650	missense	probably damaging	1.00
R1612:Adamts7	UTSW	9	90188697	missense	possibly damaging	0.86
R1652:Adamts7	UTSW	9	90189644	missense	probably damaging	1.00
R2007:Adamts7	UTSW	9	90177856	missense	probably damaging	1.00
R2091:Adamts7	UTSW	9	90188440	critical splice donor site	probably null
R2202:Adamts7	UTSW	9	90180676	missense	probably damaging	1.00
R2204:Adamts7	UTSW	9	90180676	missense	probably damaging	1.00
R2205:Adamts7	UTSW	9	90180676	missense	probably damaging	1.00
R2305:Adamts7	UTSW	9	90180711	missense	probably benign	0.39
R2409:Adamts7	UTSW	9	90180687	missense	probably damaging	1.00
R4157:Adamts7	UTSW	9	90188361	missense	probably damaging	1.00
R4210:Adamts7	UTSW	9	90194010	missense	possibly damaging	0.95
R4368:Adamts7	UTSW	9	90195851	critical splice donor site	probably null
R4533:Adamts7	UTSW	9	90180708	missense	probably damaging	1.00
R4608:Adamts7	UTSW	9	90174540	missense	probably damaging	1.00
R4623:Adamts7	UTSW	9	90186462	missense	probably benign	0.17
R4661:Adamts7	UTSW	9	90193330	missense	probably benign	0.02
R4820:Adamts7	UTSW	9	90189686	missense	possibly damaging	0.62
R4942:Adamts7	UTSW	9	90163311	missense	probably benign
R4961:Adamts7	UTSW	9	90185740	missense	probably damaging	1.00
R5064:Adamts7	UTSW	9	90195830	missense	probably damaging	1.00
R5763:Adamts7	UTSW	9	90188409	missense	probably damaging	1.00
R5921:Adamts7	UTSW	9	90188694	missense	probably benign	0.20
R6027:Adamts7	UTSW	9	90191025	missense	probably damaging	1.00
R6182:Adamts7	UTSW	9	90192436	missense	probably benign	0.01
R6306:Adamts7	UTSW	9	90178278	critical splice donor site	probably null
R6404:Adamts7	UTSW	9	90180456	splice site	probably null
R6488:Adamts7	UTSW	9	90171482	missense	probably benign	0.00
R6649:Adamts7	UTSW	9	90191937	missense	probably damaging	1.00
R6658:Adamts7	UTSW	9	90195300	missense	probably damaging	0.99
R6874:Adamts7	UTSW	9	90188731	missense	probably damaging	1.00
R6947:Adamts7	UTSW	9	90191804	splice site	probably null
R7110:Adamts7	UTSW	9	90193964	missense	possibly damaging	0.92
R7224:Adamts7	UTSW	9	90185815	missense	probably damaging	1.00
R7239:Adamts7	UTSW	9	90186557	splice site	probably null
R7519:Adamts7	UTSW	9	90197079	missense	probably benign	0.22
R7608:Adamts7	UTSW	9	90173773	missense	possibly damaging	0.68
R7635:Adamts7	UTSW	9	90195245	missense	probably damaging	1.00
R7699:Adamts7	UTSW	9	90188739	missense	probably damaging	1.00
R8519:Adamts7	UTSW	9	90193557	nonsense	probably null
R8680:Adamts7	UTSW	9	90195268	missense	probably damaging	1.00
R8743:Adamts7	UTSW	9	90195243	missense	probably damaging	0.99
R8784:Adamts7	UTSW	9	90193865	missense	probably null	0.00
R8794:Adamts7	UTSW	9	90194186	nonsense	probably null
R8851:Adamts7	UTSW	9	90193110	missense	probably benign	0.00
R9025:Adamts7	UTSW	9	90185795	nonsense	probably null
R9038:Adamts7	UTSW	9	90174639	missense
R9101:Adamts7	UTSW	9	90189741	critical splice donor site	probably null
R9256:Adamts7	UTSW	9	90178165	missense	probably damaging	1.00
R9261:Adamts7	UTSW	9	90193344	missense	probably benign	0.01
R9614:Adamts7	UTSW	9	90195198	missense	probably damaging	1.00
X0028:Adamts7	UTSW	9	90178217	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- CCTTGGGAGCAGAGATAGTTAAC -3'
(R):5'- CAGAGTACAGACTGTGGCATG -3'

Sequencing Primer
(F):5'- AGTTAACTGCTGGTGACATTTGAC -3'
(R):5'- AGACTGTGGCATGATATTCACCCTG -3'

Posted On

2022-04-18