Incidental Mutation 'R9385:Sfi1'
ID 710272
Institutional Source Beutler Lab
Gene Symbol Sfi1
Ensembl Gene ENSMUSG00000023764
Gene Name Sfi1 homolog, spindle assembly associated (yeast)
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock # R9385 (G1)
Quality Score 207.468
Status Not validated
Chromosome 11
Chromosomal Location 3131850-3193463 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) ACA to ACATCTTCCCAAAGCCAGTCA at 3153382 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066391] [ENSMUST00000081318] [ENSMUST00000101655] [ENSMUST00000132893] [ENSMUST00000140846] [ENSMUST00000153425]
AlphaFold Q3UZY0
Predicted Effect probably benign
Transcript: ENSMUST00000066391
SMART Domains Protein: ENSMUSP00000067261
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_2 34 236 4.95e-5 PROSPERO
internal_repeat_1 78 336 3.02e-14 PROSPERO
low complexity region 342 358 N/A INTRINSIC
internal_repeat_1 372 636 3.02e-14 PROSPERO
internal_repeat_2 574 804 4.95e-5 PROSPERO
low complexity region 809 821 N/A INTRINSIC
low complexity region 849 860 N/A INTRINSIC
coiled coil region 1086 1112 N/A INTRINSIC
coiled coil region 1138 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081318
SMART Domains Protein: ENSMUSP00000080066
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_3 55 275 2e-6 PROSPERO
internal_repeat_1 67 288 7.56e-9 PROSPERO
internal_repeat_2 93 401 1.18e-6 PROSPERO
internal_repeat_3 380 607 2e-6 PROSPERO
internal_repeat_1 428 651 7.56e-9 PROSPERO
internal_repeat_2 524 836 1.18e-6 PROSPERO
low complexity region 841 853 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
coiled coil region 1118 1144 N/A INTRINSIC
coiled coil region 1170 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101655
SMART Domains Protein: ENSMUSP00000099178
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_3 55 275 1.77e-6 PROSPERO
internal_repeat_1 67 288 6.51e-9 PROSPERO
internal_repeat_2 93 401 1.04e-6 PROSPERO
internal_repeat_3 380 607 1.77e-6 PROSPERO
internal_repeat_1 428 651 6.51e-9 PROSPERO
internal_repeat_2 524 836 1.04e-6 PROSPERO
low complexity region 841 853 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
coiled coil region 1107 1133 N/A INTRINSIC
coiled coil region 1159 1189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120853
Predicted Effect probably benign
Transcript: ENSMUST00000126746
SMART Domains Protein: ENSMUSP00000122002
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
low complexity region 73 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132893
SMART Domains Protein: ENSMUSP00000118419
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
low complexity region 210 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138126
Predicted Effect probably benign
Transcript: ENSMUST00000140846
SMART Domains Protein: ENSMUSP00000119905
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_1 3 301 3.65e-15 PROSPERO
internal_repeat_2 12 320 8.53e-7 PROSPERO
internal_repeat_1 301 599 3.65e-15 PROSPERO
internal_repeat_2 443 755 8.53e-7 PROSPERO
low complexity region 760 772 N/A INTRINSIC
low complexity region 800 811 N/A INTRINSIC
coiled coil region 1026 1052 N/A INTRINSIC
coiled coil region 1078 1108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144778
Predicted Effect probably benign
Transcript: ENSMUST00000153425
SMART Domains Protein: ENSMUSP00000121719
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_1 67 288 6.06e-9 PROSPERO
internal_repeat_3 69 314 2.4e-5 PROSPERO
internal_repeat_2 93 340 2.83e-6 PROSPERO
low complexity region 342 358 N/A INTRINSIC
internal_repeat_1 397 620 6.06e-9 PROSPERO
internal_repeat_2 493 744 2.83e-6 PROSPERO
internal_repeat_3 531 799 2.4e-5 PROSPERO
low complexity region 810 822 N/A INTRINSIC
low complexity region 850 861 N/A INTRINSIC
coiled coil region 1076 1102 N/A INTRINSIC
coiled coil region 1128 1158 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156655
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,161,192 I554T possibly damaging Het
4930435E12Rik T G 16: 38,828,045 D234A probably benign Het
Adamts7 C A 9: 90,195,205 C1308* probably null Het
Ank2 A G 3: 126,959,717 V305A probably benign Het
Apob A G 12: 8,006,399 N1627S possibly damaging Het
Atp10a A T 7: 58,828,139 Q1310L probably benign Het
Atp8b4 A T 2: 126,480,631 Y29* probably null Het
Card11 C A 5: 140,885,521 R742S probably benign Het
Ccdc88a A G 11: 29,455,422 D365G probably benign Het
Ccdc88b G A 19: 6,856,165 R211W probably benign Het
Cda T G 4: 138,351,287 I55L probably benign Het
Cdkl3 A C 11: 52,035,952 E577D probably benign Het
Cel T C 2: 28,560,575 D146G probably damaging Het
Cmya5 A G 13: 93,094,372 S1403P probably damaging Het
Cntn2 G A 1: 132,528,174 S202L probably damaging Het
Col15a1 C T 4: 47,300,473 Q1045* probably null Het
Csmd1 T C 8: 15,984,756 T2472A probably benign Het
Ctbp2 G A 7: 132,999,340 R22C probably benign Het
Ddit4 A G 10: 59,951,356 S53P probably damaging Het
Ddx52 G T 11: 83,952,270 C365F probably damaging Het
Dnhd1 C A 7: 105,712,765 L3677I probably damaging Het
Dscam T C 16: 97,039,003 T135A probably benign Het
Espl1 T A 15: 102,298,750 D216E probably damaging Het
Fsip2 T A 2: 82,989,449 D5175E possibly damaging Het
Fxr1 A G 3: 34,019,971 probably benign Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gm3264 T C 14: 4,871,178 I8T possibly damaging Het
Gm35339 A G 15: 76,356,167 T352A Het
Gsdmc A T 15: 63,803,637 Y110N possibly damaging Het
H13 A G 2: 152,695,493 N286S probably benign Het
Heatr1 A G 13: 12,406,542 D441G probably damaging Het
Hist1h2aa A T 13: 23,934,696 I79F probably damaging Het
Hps6 A G 19: 46,005,910 D762G probably damaging Het
Hyou1 C A 9: 44,381,515 Q141K probably benign Het
Lpin3 T C 2: 160,897,073 I267T probably benign Het
Mdc1 A G 17: 35,850,504 K770E probably benign Het
Mlh3 C T 12: 85,269,370 R14H probably damaging Het
Nfxl1 C A 5: 72,537,407 V478F probably benign Het
Nhlrc3 A G 3: 53,453,594 W247R probably damaging Het
Nlrc3 C T 16: 3,964,012 G527D probably damaging Het
Nop9 A G 14: 55,751,127 E342G probably benign Het
Ntn1 C A 11: 68,385,187 G312C probably damaging Het
Olfr288 C T 15: 98,187,605 S64N probably damaging Het
Olfr474 T A 7: 107,955,573 *311K probably null Het
Opcml T C 9: 28,675,163 V59A possibly damaging Het
Opn1sw T G 6: 29,379,426 Y193S probably damaging Het
Pabpc4l A T 3: 46,446,702 V169E probably damaging Het
Pde3a A G 6: 141,492,256 D1017G probably benign Het
Plagl2 C T 2: 153,232,318 C221Y probably damaging Het
Plppr4 G T 3: 117,322,728 N493K possibly damaging Het
Plxna2 T C 1: 194,749,416 V571A possibly damaging Het
Pnma2 A G 14: 66,915,922 probably benign Het
Rnf123 T A 9: 108,052,268 E1234D probably benign Het
Slc22a23 T C 13: 34,344,578 S74G probably benign Het
Slc36a4 T C 9: 15,734,267 I330T probably damaging Het
Snrk A T 9: 122,166,397 D414V probably benign Het
Snrnp200 G A 2: 127,238,058 probably null Het
Spata31d1b T C 13: 59,715,589 S184P probably damaging Het
Tas2r140 A T 6: 133,055,278 N172K probably benign Het
Tbc1d4 G T 14: 101,462,920 Q858K probably damaging Het
Tial1 A G 7: 128,442,485 C102R unknown Het
Ugt8a A T 3: 125,871,614 D411E probably benign Het
Usp34 A G 11: 23,449,223 D2404G Het
Vmn1r10 A C 6: 57,113,848 I142L probably benign Het
Wdr66 T C 5: 123,288,815 L919S probably damaging Het
Xpo7 A T 14: 70,688,293 D435E probably damaging Het
Zmym1 A G 4: 127,058,890 S33P probably damaging Het
Other mutations in Sfi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Sfi1 APN 11 3134337 missense probably benign 0.05
IGL00990:Sfi1 APN 11 3135671 missense probably damaging 0.99
IGL00990:Sfi1 APN 11 3143689 splice site probably benign
IGL03147:Sfi1 UTSW 11 3186080 missense possibly damaging 0.94
R0081:Sfi1 UTSW 11 3146254 frame shift probably null
R0082:Sfi1 UTSW 11 3146254 frame shift probably null
R0118:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0197:Sfi1 UTSW 11 3146254 frame shift probably null
R0241:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0241:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0242:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0816:Sfi1 UTSW 11 3146254 frame shift probably null
R1147:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1148:Sfi1 UTSW 11 3146254 frame shift probably null
R1148:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1185:Sfi1 UTSW 11 3146254 frame shift probably null
R1185:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1207:Sfi1 UTSW 11 3146254 frame shift probably null
R1207:Sfi1 UTSW 11 3146255 frame shift probably null
R1207:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1403:Sfi1 UTSW 11 3146254 frame shift probably null
R1403:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1404:Sfi1 UTSW 11 3146254 frame shift probably null
R1404:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1405:Sfi1 UTSW 11 3146254 frame shift probably null
R1405:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1465:Sfi1 UTSW 11 3146254 frame shift probably null
R1469:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1470:Sfi1 UTSW 11 3146254 frame shift probably null
R1470:Sfi1 UTSW 11 3146255 frame shift probably null
R1574:Sfi1 UTSW 11 3146254 frame shift probably null
R2871:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R5228:Sfi1 UTSW 11 3153384 intron probably benign
R5276:Sfi1 UTSW 11 3153384 intron probably benign
R5298:Sfi1 UTSW 11 3153384 intron probably benign
R5343:Sfi1 UTSW 11 3153384 intron probably benign
R5376:Sfi1 UTSW 11 3153384 intron probably benign
R5384:Sfi1 UTSW 11 3153382 intron probably benign
R5385:Sfi1 UTSW 11 3153382 intron probably benign
R5386:Sfi1 UTSW 11 3153384 intron probably benign
R5411:Sfi1 UTSW 11 3153384 intron probably benign
R5431:Sfi1 UTSW 11 3153384 intron probably benign
R5795:Sfi1 UTSW 11 3153384 intron probably benign
R5808:Sfi1 UTSW 11 3153384 intron probably benign
R7536:Sfi1 UTSW 11 3153382 intron probably benign
R7642:Sfi1 UTSW 11 3153382 intron probably benign
R8111:Sfi1 UTSW 11 3146254 frame shift probably null
R8891:Sfi1 UTSW 11 3153384 intron probably benign
R8977:Sfi1 UTSW 11 3153382 intron probably benign
R9118:Sfi1 UTSW 11 3153382 intron probably benign
R9170:Sfi1 UTSW 11 3153384 intron probably benign
R9559:Sfi1 UTSW 11 3153382 intron probably benign
R9560:Sfi1 UTSW 11 3153382 intron probably benign
R9715:Sfi1 UTSW 11 3153382 intron probably benign
Z1186:Sfi1 UTSW 11 3153382 intron probably benign
Predicted Primers
Posted On 2022-04-18