Incidental Mutation 'R9385:Ccdc88a'
ID 710274
Institutional Source Beutler Lab
Gene Symbol Ccdc88a
Ensembl Gene ENSMUSG00000032740
Gene Name coiled coil domain containing 88A
Synonyms Girdin, GIV, A430106J12Rik, D130005J21Rik, HkRP1, C130096N06Rik, C330012F17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 29373658-29510808 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29455422 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 365 (D365G)
Ref Sequence ENSEMBL: ENSMUSP00000048978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040182]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040182
AA Change: D365G

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000048978
Gene: ENSMUSG00000032740
AA Change: D365G

DomainStartEndE-ValueType
Pfam:HOOK 14 590 8.1e-36 PFAM
low complexity region 614 625 N/A INTRINSIC
Blast:BRLZ 665 719 6e-22 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
low complexity region 955 985 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1268 1385 N/A INTRINSIC
low complexity region 1437 1444 N/A INTRINSIC
low complexity region 1566 1576 N/A INTRINSIC
internal_repeat_1 1609 1702 2.38e-6 PROSPERO
internal_repeat_1 1708 1808 2.38e-6 PROSPERO
low complexity region 1811 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Girdin family of coiled-coil domain containing proteins. The encoded protein is an actin-binding protein that is activated by the serine/threonine kinase Akt and plays a role in cytoskeleton remodeling and cell migration. The encoded protein also enhances Akt signaling by mediating phosphoinositide 3-kinase (PI3K)-dependent activation of Akt by growth factor receptor tyrosine kinases and G protein-coupled receptors. Increased expression of this gene and phosphorylation of the encoded protein may play a role in cancer metastasis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal weight loss, reduced angiogenesis, and premature death by P25. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,161,192 I554T possibly damaging Het
4930435E12Rik T G 16: 38,828,045 D234A probably benign Het
Adamts7 C A 9: 90,195,205 C1308* probably null Het
Ank2 A G 3: 126,959,717 V305A probably benign Het
Apob A G 12: 8,006,399 N1627S possibly damaging Het
Atp10a A T 7: 58,828,139 Q1310L probably benign Het
Atp8b4 A T 2: 126,480,631 Y29* probably null Het
Card11 C A 5: 140,885,521 R742S probably benign Het
Ccdc88b G A 19: 6,856,165 R211W probably benign Het
Cda T G 4: 138,351,287 I55L probably benign Het
Cdkl3 A C 11: 52,035,952 E577D probably benign Het
Cel T C 2: 28,560,575 D146G probably damaging Het
Cmya5 A G 13: 93,094,372 S1403P probably damaging Het
Cntn2 G A 1: 132,528,174 S202L probably damaging Het
Col15a1 C T 4: 47,300,473 Q1045* probably null Het
Csmd1 T C 8: 15,984,756 T2472A probably benign Het
Ctbp2 G A 7: 132,999,340 R22C probably benign Het
Ddit4 A G 10: 59,951,356 S53P probably damaging Het
Ddx52 G T 11: 83,952,270 C365F probably damaging Het
Dnhd1 C A 7: 105,712,765 L3677I probably damaging Het
Dscam T C 16: 97,039,003 T135A probably benign Het
Espl1 T A 15: 102,298,750 D216E probably damaging Het
Fsip2 T A 2: 82,989,449 D5175E possibly damaging Het
Fxr1 A G 3: 34,019,971 probably benign Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gm3264 T C 14: 4,871,178 I8T possibly damaging Het
Gm35339 A G 15: 76,356,167 T352A Het
Gsdmc A T 15: 63,803,637 Y110N possibly damaging Het
H13 A G 2: 152,695,493 N286S probably benign Het
Heatr1 A G 13: 12,406,542 D441G probably damaging Het
Hist1h2aa A T 13: 23,934,696 I79F probably damaging Het
Hps6 A G 19: 46,005,910 D762G probably damaging Het
Hyou1 C A 9: 44,381,515 Q141K probably benign Het
Lpin3 T C 2: 160,897,073 I267T probably benign Het
Mdc1 A G 17: 35,850,504 K770E probably benign Het
Mlh3 C T 12: 85,269,370 R14H probably damaging Het
Nfxl1 C A 5: 72,537,407 V478F probably benign Het
Nhlrc3 A G 3: 53,453,594 W247R probably damaging Het
Nlrc3 C T 16: 3,964,012 G527D probably damaging Het
Nop9 A G 14: 55,751,127 E342G probably benign Het
Ntn1 C A 11: 68,385,187 G312C probably damaging Het
Olfr288 C T 15: 98,187,605 S64N probably damaging Het
Olfr474 T A 7: 107,955,573 *311K probably null Het
Opcml T C 9: 28,675,163 V59A possibly damaging Het
Opn1sw T G 6: 29,379,426 Y193S probably damaging Het
Pabpc4l A T 3: 46,446,702 V169E probably damaging Het
Pde3a A G 6: 141,492,256 D1017G probably benign Het
Plagl2 C T 2: 153,232,318 C221Y probably damaging Het
Plppr4 G T 3: 117,322,728 N493K possibly damaging Het
Plxna2 T C 1: 194,749,416 V571A possibly damaging Het
Pnma2 A G 14: 66,915,922 probably benign Het
Rnf123 T A 9: 108,052,268 E1234D probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc22a23 T C 13: 34,344,578 S74G probably benign Het
Slc36a4 T C 9: 15,734,267 I330T probably damaging Het
Snrk A T 9: 122,166,397 D414V probably benign Het
Snrnp200 G A 2: 127,238,058 probably null Het
Spata31d1b T C 13: 59,715,589 S184P probably damaging Het
Tas2r140 A T 6: 133,055,278 N172K probably benign Het
Tbc1d4 G T 14: 101,462,920 Q858K probably damaging Het
Tial1 A G 7: 128,442,485 C102R unknown Het
Ugt8a A T 3: 125,871,614 D411E probably benign Het
Usp34 A G 11: 23,449,223 D2404G Het
Vmn1r10 A C 6: 57,113,848 I142L probably benign Het
Wdr66 T C 5: 123,288,815 L919S probably damaging Het
Xpo7 A T 14: 70,688,293 D435E probably damaging Het
Zmym1 A G 4: 127,058,890 S33P probably damaging Het
Other mutations in Ccdc88a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Ccdc88a APN 11 29499341 missense probably benign 0.24
IGL00577:Ccdc88a APN 11 29424772 missense probably damaging 1.00
IGL00766:Ccdc88a APN 11 29501046 missense probably damaging 0.99
IGL01384:Ccdc88a APN 11 29503915 missense probably damaging 0.99
IGL01541:Ccdc88a APN 11 29400283 missense probably benign
IGL01647:Ccdc88a APN 11 29504321 unclassified probably benign
IGL02648:Ccdc88a APN 11 29501051 missense probably benign 0.28
IGL02885:Ccdc88a APN 11 29448050 missense probably damaging 1.00
IGL03117:Ccdc88a APN 11 29374559 missense probably damaging 1.00
IGL03196:Ccdc88a APN 11 29482340 missense possibly damaging 0.56
trailor UTSW 11 29494099 splice site probably null
R0011:Ccdc88a UTSW 11 29374364 missense probably damaging 1.00
R0011:Ccdc88a UTSW 11 29374364 missense probably damaging 1.00
R0083:Ccdc88a UTSW 11 29503463 missense probably damaging 0.99
R0108:Ccdc88a UTSW 11 29503463 missense probably damaging 0.99
R0326:Ccdc88a UTSW 11 29461021 missense probably benign 0.01
R0565:Ccdc88a UTSW 11 29461042 unclassified probably benign
R0631:Ccdc88a UTSW 11 29493752 missense probably damaging 0.98
R0632:Ccdc88a UTSW 11 29482749 unclassified probably benign
R0762:Ccdc88a UTSW 11 29463112 unclassified probably benign
R0838:Ccdc88a UTSW 11 29400285 missense probably damaging 1.00
R0946:Ccdc88a UTSW 11 29456509 missense probably benign
R1192:Ccdc88a UTSW 11 29504049 missense possibly damaging 0.45
R1500:Ccdc88a UTSW 11 29482713 missense probably benign 0.00
R1701:Ccdc88a UTSW 11 29477427 missense possibly damaging 0.59
R1826:Ccdc88a UTSW 11 29489637 missense possibly damaging 0.58
R1902:Ccdc88a UTSW 11 29461788 missense probably benign 0.07
R1903:Ccdc88a UTSW 11 29461788 missense probably benign 0.07
R2021:Ccdc88a UTSW 11 29503480 missense probably damaging 1.00
R2023:Ccdc88a UTSW 11 29463546 nonsense probably null
R2284:Ccdc88a UTSW 11 29494099 splice site probably null
R3236:Ccdc88a UTSW 11 29447995 missense possibly damaging 0.51
R3409:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3410:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3411:Ccdc88a UTSW 11 29486006 missense probably damaging 1.00
R3430:Ccdc88a UTSW 11 29448033 missense probably damaging 0.98
R3620:Ccdc88a UTSW 11 29430227 missense probably benign 0.16
R4204:Ccdc88a UTSW 11 29463399 missense probably damaging 1.00
R4515:Ccdc88a UTSW 11 29482651 missense probably benign 0.01
R4518:Ccdc88a UTSW 11 29482651 missense probably benign 0.01
R4519:Ccdc88a UTSW 11 29482651 missense probably benign 0.01
R4693:Ccdc88a UTSW 11 29482241 missense probably damaging 1.00
R4705:Ccdc88a UTSW 11 29422586 missense probably benign
R4707:Ccdc88a UTSW 11 29447956 missense probably benign
R4732:Ccdc88a UTSW 11 29485906 missense probably benign 0.02
R4733:Ccdc88a UTSW 11 29485906 missense probably benign 0.02
R4734:Ccdc88a UTSW 11 29482720 missense probably benign
R4749:Ccdc88a UTSW 11 29482720 missense probably benign
R4817:Ccdc88a UTSW 11 29460907 missense probably benign 0.15
R4828:Ccdc88a UTSW 11 29463210 missense probably damaging 1.00
R4979:Ccdc88a UTSW 11 29482133 nonsense probably null
R5288:Ccdc88a UTSW 11 29498416 missense possibly damaging 0.77
R5373:Ccdc88a UTSW 11 29463409 missense possibly damaging 0.92
R5374:Ccdc88a UTSW 11 29463409 missense possibly damaging 0.92
R5401:Ccdc88a UTSW 11 29463279 missense probably benign 0.00
R5586:Ccdc88a UTSW 11 29503484 missense probably benign 0.00
R6660:Ccdc88a UTSW 11 29482663 missense probably benign 0.01
R7116:Ccdc88a UTSW 11 29504051 missense probably benign 0.01
R7353:Ccdc88a UTSW 11 29463368 missense probably benign 0.00
R7538:Ccdc88a UTSW 11 29463370 missense probably benign 0.00
R7663:Ccdc88a UTSW 11 29498614 critical splice donor site probably null
R7769:Ccdc88a UTSW 11 29482381 missense probably damaging 1.00
R7798:Ccdc88a UTSW 11 29477348 missense probably benign 0.15
R7810:Ccdc88a UTSW 11 29485964 missense probably damaging 1.00
R7826:Ccdc88a UTSW 11 29503563 missense probably benign 0.02
R7956:Ccdc88a UTSW 11 29463892 missense probably damaging 1.00
R8260:Ccdc88a UTSW 11 29493934 missense probably benign 0.01
R8402:Ccdc88a UTSW 11 29463879 missense probably damaging 1.00
R8409:Ccdc88a UTSW 11 29503544 missense probably benign
R8555:Ccdc88a UTSW 11 29430169 missense probably benign
R8676:Ccdc88a UTSW 11 29460860 missense probably benign 0.05
R8846:Ccdc88a UTSW 11 29464185 missense probably damaging 1.00
R8963:Ccdc88a UTSW 11 29498416 missense possibly damaging 0.77
R8972:Ccdc88a UTSW 11 29485888 missense probably benign 0.07
R9353:Ccdc88a UTSW 11 29477433 missense probably damaging 1.00
R9362:Ccdc88a UTSW 11 29503922 missense probably null 0.55
R9509:Ccdc88a UTSW 11 29464143 missense probably benign 0.27
R9610:Ccdc88a UTSW 11 29477316 missense possibly damaging 0.76
R9611:Ccdc88a UTSW 11 29477316 missense possibly damaging 0.76
R9664:Ccdc88a UTSW 11 29455484 missense probably benign 0.08
R9720:Ccdc88a UTSW 11 29463813 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTGTGACCCGCTTAAATG -3'
(R):5'- GGGAATTTAGCTGAATCCTAGAATG -3'

Sequencing Primer
(F):5'- CAATTCCCTGTGAAGTTATAGTGG -3'
(R):5'- GCTGAATCCTAGAATGTGAATCAC -3'
Posted On 2022-04-18