Incidental Mutation 'R9385:Slc22a23'
ID 710283
Institutional Source Beutler Lab
Gene Symbol Slc22a23
Ensembl Gene ENSMUSG00000038267
Gene Name solute carrier family 22, member 23
Synonyms 3110004L20Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.174) question?
Stock # R9385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 34363141-34529165 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34528561 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 74 (S74G)
Ref Sequence ENSEMBL: ENSMUSP00000042742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040336]
AlphaFold Q3UHH2
Predicted Effect probably benign
Transcript: ENSMUST00000040336
AA Change: S74G

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000042742
Gene: ENSMUSG00000038267
AA Change: S74G

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
Pfam:Sugar_tr 187 633 5e-26 PFAM
Pfam:MFS_1 224 518 2.6e-13 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122376
Gene: ENSMUSG00000038267
AA Change: S6G

DomainStartEndE-ValueType
low complexity region 86 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148390
SMART Domains Protein: ENSMUSP00000122283
Gene: ENSMUSG00000038267

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
Pfam:Sugar_tr 71 510 1.4e-27 PFAM
Pfam:MFS_1 109 402 1.5e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A23 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,207,966 (GRCm39) I554T possibly damaging Het
Adamts7 C A 9: 90,077,258 (GRCm39) C1308* probably null Het
Ank2 A G 3: 126,753,366 (GRCm39) V305A probably benign Het
Apob A G 12: 8,056,399 (GRCm39) N1627S possibly damaging Het
Atp10a A T 7: 58,477,887 (GRCm39) Q1310L probably benign Het
Atp8b4 A T 2: 126,322,551 (GRCm39) Y29* probably null Het
Card11 C A 5: 140,871,276 (GRCm39) R742S probably benign Het
Ccdc88a A G 11: 29,405,422 (GRCm39) D365G probably benign Het
Ccdc88b G A 19: 6,833,533 (GRCm39) R211W probably benign Het
Cda T G 4: 138,078,598 (GRCm39) I55L probably benign Het
Cdkl3 A C 11: 51,926,779 (GRCm39) E577D probably benign Het
Cel T C 2: 28,450,587 (GRCm39) D146G probably damaging Het
Cfap251 T C 5: 123,426,878 (GRCm39) L919S probably damaging Het
Cmya5 A G 13: 93,230,880 (GRCm39) S1403P probably damaging Het
Cntn2 G A 1: 132,455,912 (GRCm39) S202L probably damaging Het
Col15a1 C T 4: 47,300,473 (GRCm39) Q1045* probably null Het
Csmd1 T C 8: 16,034,756 (GRCm39) T2472A probably benign Het
Ctbp2 G A 7: 132,601,069 (GRCm39) R22C probably benign Het
Ddit4 A G 10: 59,787,178 (GRCm39) S53P probably damaging Het
Ddx52 G T 11: 83,843,096 (GRCm39) C365F probably damaging Het
Dnhd1 C A 7: 105,361,972 (GRCm39) L3677I probably damaging Het
Dscam T C 16: 96,840,203 (GRCm39) T135A probably benign Het
Espl1 T A 15: 102,207,185 (GRCm39) D216E probably damaging Het
Fsip2 T A 2: 82,819,793 (GRCm39) D5175E possibly damaging Het
Fxr1 A G 3: 34,074,120 (GRCm39) probably benign Het
Fyb1 A G 15: 6,664,297 (GRCm39) D460G probably benign Het
Gm3264 T C 14: 16,058,217 (GRCm39) I8T possibly damaging Het
Gsdmc A T 15: 63,675,486 (GRCm39) Y110N possibly damaging Het
H13 A G 2: 152,537,413 (GRCm39) N286S probably benign Het
H2ac1 A T 13: 24,118,679 (GRCm39) I79F probably damaging Het
Heatr1 A G 13: 12,421,423 (GRCm39) D441G probably damaging Het
Hps6 A G 19: 45,994,349 (GRCm39) D762G probably damaging Het
Hyou1 C A 9: 44,292,812 (GRCm39) Q141K probably benign Het
Lpin3 T C 2: 160,738,993 (GRCm39) I267T probably benign Het
Mdc1 A G 17: 36,161,396 (GRCm39) K770E probably benign Het
Mlh3 C T 12: 85,316,144 (GRCm39) R14H probably damaging Het
Nfxl1 C A 5: 72,694,750 (GRCm39) V478F probably benign Het
Nhlrc3 A G 3: 53,361,015 (GRCm39) W247R probably damaging Het
Nlrc3 C T 16: 3,781,876 (GRCm39) G527D probably damaging Het
Nop9 A G 14: 55,988,584 (GRCm39) E342G probably benign Het
Ntn1 C A 11: 68,276,013 (GRCm39) G312C probably damaging Het
Opcml T C 9: 28,586,459 (GRCm39) V59A possibly damaging Het
Opn1sw T G 6: 29,379,425 (GRCm39) Y193S probably damaging Het
Or10ad1c C T 15: 98,085,486 (GRCm39) S64N probably damaging Het
Or5p54 T A 7: 107,554,780 (GRCm39) *311K probably null Het
Pabpc4l A T 3: 46,401,137 (GRCm39) V169E probably damaging Het
Pde3a A G 6: 141,437,982 (GRCm39) D1017G probably benign Het
Plagl2 C T 2: 153,074,238 (GRCm39) C221Y probably damaging Het
Plppr4 G T 3: 117,116,377 (GRCm39) N493K possibly damaging Het
Plxna2 T C 1: 194,431,724 (GRCm39) V571A possibly damaging Het
Pnma2 A G 14: 67,153,371 (GRCm39) probably benign Het
Rnf123 T A 9: 107,929,467 (GRCm39) E1234D probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,103,382 (GRCm39) probably benign Het
Slc36a4 T C 9: 15,645,563 (GRCm39) I330T probably damaging Het
Snrk A T 9: 121,995,463 (GRCm39) D414V probably benign Het
Snrnp200 G A 2: 127,079,978 (GRCm39) probably null Het
Spata31d1b T C 13: 59,863,403 (GRCm39) S184P probably damaging Het
Tas2r140 A T 6: 133,032,241 (GRCm39) N172K probably benign Het
Tbc1d4 G T 14: 101,700,356 (GRCm39) Q858K probably damaging Het
Tex55 T G 16: 38,648,407 (GRCm39) D234A probably benign Het
Tial1 A G 7: 128,044,209 (GRCm39) C102R unknown Het
Ugt8a A T 3: 125,665,263 (GRCm39) D411E probably benign Het
Usp34 A G 11: 23,399,223 (GRCm39) D2404G Het
Vmn1r10 A C 6: 57,090,833 (GRCm39) I142L probably benign Het
Wdr97 A G 15: 76,240,367 (GRCm39) T352A Het
Xpo7 A T 14: 70,925,733 (GRCm39) D435E probably damaging Het
Zmym1 A G 4: 126,952,683 (GRCm39) S33P probably damaging Het
Other mutations in Slc22a23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slc22a23 APN 13 34,489,228 (GRCm39) missense probably damaging 1.00
IGL01762:Slc22a23 APN 13 34,387,984 (GRCm39) missense possibly damaging 0.71
IGL02496:Slc22a23 APN 13 34,528,468 (GRCm39) missense possibly damaging 0.93
IGL02516:Slc22a23 APN 13 34,387,938 (GRCm39) missense probably benign 0.02
IGL02831:Slc22a23 APN 13 34,483,052 (GRCm39) missense possibly damaging 0.81
Foreshadowed UTSW 13 34,379,462 (GRCm39) missense probably damaging 0.98
foretold UTSW 13 34,489,163 (GRCm39) missense probably benign 0.08
BB009:Slc22a23 UTSW 13 34,366,960 (GRCm39) missense probably damaging 0.99
BB019:Slc22a23 UTSW 13 34,366,960 (GRCm39) missense probably damaging 0.99
R0234:Slc22a23 UTSW 13 34,367,244 (GRCm39) missense probably damaging 1.00
R0234:Slc22a23 UTSW 13 34,367,244 (GRCm39) missense probably damaging 1.00
R0413:Slc22a23 UTSW 13 34,367,115 (GRCm39) missense probably damaging 1.00
R0557:Slc22a23 UTSW 13 34,528,366 (GRCm39) missense possibly damaging 0.50
R0558:Slc22a23 UTSW 13 34,528,366 (GRCm39) missense possibly damaging 0.50
R0636:Slc22a23 UTSW 13 34,483,076 (GRCm39) missense probably benign 0.01
R0676:Slc22a23 UTSW 13 34,379,462 (GRCm39) missense probably damaging 0.98
R0739:Slc22a23 UTSW 13 34,528,366 (GRCm39) missense possibly damaging 0.50
R0990:Slc22a23 UTSW 13 34,379,450 (GRCm39) missense probably damaging 1.00
R1515:Slc22a23 UTSW 13 34,387,947 (GRCm39) missense probably benign 0.33
R2128:Slc22a23 UTSW 13 34,387,953 (GRCm39) missense possibly damaging 0.76
R2147:Slc22a23 UTSW 13 34,366,990 (GRCm39) missense probably benign 0.00
R3113:Slc22a23 UTSW 13 34,367,058 (GRCm39) missense probably damaging 0.98
R3780:Slc22a23 UTSW 13 34,528,323 (GRCm39) missense probably benign 0.14
R3945:Slc22a23 UTSW 13 34,367,109 (GRCm39) missense probably damaging 0.98
R3946:Slc22a23 UTSW 13 34,367,109 (GRCm39) missense probably damaging 0.98
R4056:Slc22a23 UTSW 13 34,482,987 (GRCm39) nonsense probably null
R4095:Slc22a23 UTSW 13 34,489,189 (GRCm39) missense probably damaging 1.00
R4854:Slc22a23 UTSW 13 34,387,924 (GRCm39) missense probably benign
R5594:Slc22a23 UTSW 13 34,489,240 (GRCm39) missense probably damaging 0.99
R5611:Slc22a23 UTSW 13 34,489,222 (GRCm39) missense probably benign 0.00
R6167:Slc22a23 UTSW 13 34,528,542 (GRCm39) missense probably damaging 0.97
R6927:Slc22a23 UTSW 13 34,528,362 (GRCm39) missense probably benign 0.07
R6933:Slc22a23 UTSW 13 34,489,163 (GRCm39) missense probably benign 0.08
R6960:Slc22a23 UTSW 13 34,528,140 (GRCm39) critical splice donor site probably null
R7291:Slc22a23 UTSW 13 34,381,822 (GRCm39) missense probably damaging 0.99
R7313:Slc22a23 UTSW 13 34,367,161 (GRCm39) missense probably damaging 1.00
R7932:Slc22a23 UTSW 13 34,366,960 (GRCm39) missense probably damaging 0.99
R8058:Slc22a23 UTSW 13 34,489,167 (GRCm39) nonsense probably null
R9560:Slc22a23 UTSW 13 34,381,851 (GRCm39) missense possibly damaging 0.51
R9630:Slc22a23 UTSW 13 34,379,390 (GRCm39) missense possibly damaging 0.93
X0064:Slc22a23 UTSW 13 34,528,449 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCCAATTGCCCATGTCAC -3'
(R):5'- AGGACTCGAACGGTTTCTGC -3'

Sequencing Primer
(F):5'- ATCGGCCGGTGACAGTG -3'
(R):5'- CCTGGCCATGGCGATAG -3'
Posted On 2022-04-18