Mutagenetix > Incidental Mutation

Incidental Mutation 'R9385:Espl1'

710295

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9385 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102298750 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 216 (D216E)

Ref Sequence

ENSEMBL: ENSMUSP00000064465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]

AlphaFold

P60330

Predicted Effect

probably damaging
Transcript: ENSMUST00000064924
AA Change: D216E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: D216E

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000229050
AA Change: D216E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000230212

Predicted Effect

probably benign
Transcript: ENSMUST00000231104

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,161,192	I554T	possibly damaging	Het
4930435E12Rik	T	G	16: 38,828,045	D234A	probably benign	Het
Adamts7	C	A	9: 90,195,205	C1308*	probably null	Het
Ank2	A	G	3: 126,959,717	V305A	probably benign	Het
Apob	A	G	12: 8,006,399	N1627S	possibly damaging	Het
Atp10a	A	T	7: 58,828,139	Q1310L	probably benign	Het
Atp8b4	A	T	2: 126,480,631	Y29*	probably null	Het
Card11	C	A	5: 140,885,521	R742S	probably benign	Het
Ccdc88a	A	G	11: 29,455,422	D365G	probably benign	Het
Ccdc88b	G	A	19: 6,856,165	R211W	probably benign	Het
Cda	T	G	4: 138,351,287	I55L	probably benign	Het
Cdkl3	A	C	11: 52,035,952	E577D	probably benign	Het
Cel	T	C	2: 28,560,575	D146G	probably damaging	Het
Cmya5	A	G	13: 93,094,372	S1403P	probably damaging	Het
Cntn2	G	A	1: 132,528,174	S202L	probably damaging	Het
Col15a1	C	T	4: 47,300,473	Q1045*	probably null	Het
Csmd1	T	C	8: 15,984,756	T2472A	probably benign	Het
Ctbp2	G	A	7: 132,999,340	R22C	probably benign	Het
Ddit4	A	G	10: 59,951,356	S53P	probably damaging	Het
Ddx52	G	T	11: 83,952,270	C365F	probably damaging	Het
Dnhd1	C	A	7: 105,712,765	L3677I	probably damaging	Het
Dscam	T	C	16: 97,039,003	T135A	probably benign	Het
Fsip2	T	A	2: 82,989,449	D5175E	possibly damaging	Het
Fxr1	A	G	3: 34,019,971		probably benign	Het
Fyb	A	G	15: 6,634,816	D460G	probably benign	Het
Gm3264	T	C	14: 4,871,178	I8T	possibly damaging	Het
Gm35339	A	G	15: 76,356,167	T352A		Het
Gsdmc	A	T	15: 63,803,637	Y110N	possibly damaging	Het
H13	A	G	2: 152,695,493	N286S	probably benign	Het
Heatr1	A	G	13: 12,406,542	D441G	probably damaging	Het
Hist1h2aa	A	T	13: 23,934,696	I79F	probably damaging	Het
Hps6	A	G	19: 46,005,910	D762G	probably damaging	Het
Hyou1	C	A	9: 44,381,515	Q141K	probably benign	Het
Lpin3	T	C	2: 160,897,073	I267T	probably benign	Het
Mdc1	A	G	17: 35,850,504	K770E	probably benign	Het
Mlh3	C	T	12: 85,269,370	R14H	probably damaging	Het
Nfxl1	C	A	5: 72,537,407	V478F	probably benign	Het
Nhlrc3	A	G	3: 53,453,594	W247R	probably damaging	Het
Nlrc3	C	T	16: 3,964,012	G527D	probably damaging	Het
Nop9	A	G	14: 55,751,127	E342G	probably benign	Het
Ntn1	C	A	11: 68,385,187	G312C	probably damaging	Het
Olfr288	C	T	15: 98,187,605	S64N	probably damaging	Het
Olfr474	T	A	7: 107,955,573	*311K	probably null	Het
Opcml	T	C	9: 28,675,163	V59A	possibly damaging	Het
Opn1sw	T	G	6: 29,379,426	Y193S	probably damaging	Het
Pabpc4l	A	T	3: 46,446,702	V169E	probably damaging	Het
Pde3a	A	G	6: 141,492,256	D1017G	probably benign	Het
Plagl2	C	T	2: 153,232,318	C221Y	probably damaging	Het
Plppr4	G	T	3: 117,322,728	N493K	possibly damaging	Het
Plxna2	T	C	1: 194,749,416	V571A	possibly damaging	Het
Pnma2	A	G	14: 66,915,922		probably benign	Het
Rnf123	T	A	9: 108,052,268	E1234D	probably benign	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Het
Slc22a23	T	C	13: 34,344,578	S74G	probably benign	Het
Slc36a4	T	C	9: 15,734,267	I330T	probably damaging	Het
Snrk	A	T	9: 122,166,397	D414V	probably benign	Het
Snrnp200	G	A	2: 127,238,058		probably null	Het
Spata31d1b	T	C	13: 59,715,589	S184P	probably damaging	Het
Tas2r140	A	T	6: 133,055,278	N172K	probably benign	Het
Tbc1d4	G	T	14: 101,462,920	Q858K	probably damaging	Het
Tial1	A	G	7: 128,442,485	C102R	unknown	Het
Ugt8a	A	T	3: 125,871,614	D411E	probably benign	Het
Usp34	A	G	11: 23,449,223	D2404G		Het
Vmn1r10	A	C	6: 57,113,848	I142L	probably benign	Het
Wdr66	T	C	5: 123,288,815	L919S	probably damaging	Het
Xpo7	A	T	14: 70,688,293	D435E	probably damaging	Het
Zmym1	A	G	4: 127,058,890	S33P	probably damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGAACTCTGGAGAGGCTG -3'
(R):5'- TGATTACGAGCCCTCTCCAC -3'

Sequencing Primer
(F):5'- TGCCCCTCAGGACTATGAG -3'
(R):5'- GAGCCCTCTCCACTGCTCTG -3'

Posted On

2022-04-18