Incidental Mutation 'R9385:4930435E12Rik'
ID 710297
Institutional Source Beutler Lab
Gene Symbol 4930435E12Rik
Ensembl Gene ENSMUSG00000022798
Gene Name RIKEN cDNA 4930435E12 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R9385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 38812206-38828749 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 38828045 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 234 (D234A)
Ref Sequence ENSEMBL: ENSMUSP00000113120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122078]
AlphaFold A6X8Z9
Predicted Effect probably benign
Transcript: ENSMUST00000122078
AA Change: D234A

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113120
Gene: ENSMUSG00000022798
AA Change: D234A

DomainStartEndE-ValueType
low complexity region 86 97 N/A INTRINSIC
low complexity region 244 254 N/A INTRINSIC
low complexity region 307 317 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,161,192 I554T possibly damaging Het
Adamts7 C A 9: 90,195,205 C1308* probably null Het
Ank2 A G 3: 126,959,717 V305A probably benign Het
Apob A G 12: 8,006,399 N1627S possibly damaging Het
Atp10a A T 7: 58,828,139 Q1310L probably benign Het
Atp8b4 A T 2: 126,480,631 Y29* probably null Het
Card11 C A 5: 140,885,521 R742S probably benign Het
Ccdc88a A G 11: 29,455,422 D365G probably benign Het
Ccdc88b G A 19: 6,856,165 R211W probably benign Het
Cda T G 4: 138,351,287 I55L probably benign Het
Cdkl3 A C 11: 52,035,952 E577D probably benign Het
Cel T C 2: 28,560,575 D146G probably damaging Het
Cmya5 A G 13: 93,094,372 S1403P probably damaging Het
Cntn2 G A 1: 132,528,174 S202L probably damaging Het
Col15a1 C T 4: 47,300,473 Q1045* probably null Het
Csmd1 T C 8: 15,984,756 T2472A probably benign Het
Ctbp2 G A 7: 132,999,340 R22C probably benign Het
Ddit4 A G 10: 59,951,356 S53P probably damaging Het
Ddx52 G T 11: 83,952,270 C365F probably damaging Het
Dnhd1 C A 7: 105,712,765 L3677I probably damaging Het
Dscam T C 16: 97,039,003 T135A probably benign Het
Espl1 T A 15: 102,298,750 D216E probably damaging Het
Fsip2 T A 2: 82,989,449 D5175E possibly damaging Het
Fxr1 A G 3: 34,019,971 probably benign Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gm3264 T C 14: 4,871,178 I8T possibly damaging Het
Gm35339 A G 15: 76,356,167 T352A Het
Gsdmc A T 15: 63,803,637 Y110N possibly damaging Het
H13 A G 2: 152,695,493 N286S probably benign Het
Heatr1 A G 13: 12,406,542 D441G probably damaging Het
Hist1h2aa A T 13: 23,934,696 I79F probably damaging Het
Hps6 A G 19: 46,005,910 D762G probably damaging Het
Hyou1 C A 9: 44,381,515 Q141K probably benign Het
Lpin3 T C 2: 160,897,073 I267T probably benign Het
Mdc1 A G 17: 35,850,504 K770E probably benign Het
Mlh3 C T 12: 85,269,370 R14H probably damaging Het
Nfxl1 C A 5: 72,537,407 V478F probably benign Het
Nhlrc3 A G 3: 53,453,594 W247R probably damaging Het
Nlrc3 C T 16: 3,964,012 G527D probably damaging Het
Nop9 A G 14: 55,751,127 E342G probably benign Het
Ntn1 C A 11: 68,385,187 G312C probably damaging Het
Olfr288 C T 15: 98,187,605 S64N probably damaging Het
Olfr474 T A 7: 107,955,573 *311K probably null Het
Opcml T C 9: 28,675,163 V59A possibly damaging Het
Opn1sw T G 6: 29,379,426 Y193S probably damaging Het
Pabpc4l A T 3: 46,446,702 V169E probably damaging Het
Pde3a A G 6: 141,492,256 D1017G probably benign Het
Plagl2 C T 2: 153,232,318 C221Y probably damaging Het
Plppr4 G T 3: 117,322,728 N493K possibly damaging Het
Plxna2 T C 1: 194,749,416 V571A possibly damaging Het
Pnma2 A G 14: 66,915,922 probably benign Het
Rnf123 T A 9: 108,052,268 E1234D probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc22a23 T C 13: 34,344,578 S74G probably benign Het
Slc36a4 T C 9: 15,734,267 I330T probably damaging Het
Snrk A T 9: 122,166,397 D414V probably benign Het
Snrnp200 G A 2: 127,238,058 probably null Het
Spata31d1b T C 13: 59,715,589 S184P probably damaging Het
Tas2r140 A T 6: 133,055,278 N172K probably benign Het
Tbc1d4 G T 14: 101,462,920 Q858K probably damaging Het
Tial1 A G 7: 128,442,485 C102R unknown Het
Ugt8a A T 3: 125,871,614 D411E probably benign Het
Usp34 A G 11: 23,449,223 D2404G Het
Vmn1r10 A C 6: 57,113,848 I142L probably benign Het
Wdr66 T C 5: 123,288,815 L919S probably damaging Het
Xpo7 A T 14: 70,688,293 D435E probably damaging Het
Zmym1 A G 4: 127,058,890 S33P probably damaging Het
Other mutations in 4930435E12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:4930435E12Rik APN 16 38827893 missense possibly damaging 0.61
IGL01998:4930435E12Rik APN 16 38828224 missense probably benign 0.00
IGL02454:4930435E12Rik APN 16 38827947 missense probably benign 0.02
IGL03216:4930435E12Rik APN 16 38828690 missense possibly damaging 0.59
IGL03325:4930435E12Rik APN 16 38827993 missense probably damaging 1.00
IGL03397:4930435E12Rik APN 16 38828693 missense probably damaging 1.00
R7924_4930435E12Rik_239 UTSW 16 38812464 nonsense probably null
BB001:4930435E12Rik UTSW 16 38812464 nonsense probably null
BB011:4930435E12Rik UTSW 16 38812464 nonsense probably null
R0242:4930435E12Rik UTSW 16 38824567 splice site probably benign
R0446:4930435E12Rik UTSW 16 38828702 missense probably benign 0.01
R0607:4930435E12Rik UTSW 16 38828364 missense probably benign 0.02
R1918:4930435E12Rik UTSW 16 38828088 missense possibly damaging 0.56
R1953:4930435E12Rik UTSW 16 38827913 missense possibly damaging 0.78
R3417:4930435E12Rik UTSW 16 38828740 missense probably benign 0.17
R4601:4930435E12Rik UTSW 16 38828018 missense probably benign 0.14
R4860:4930435E12Rik UTSW 16 38828145 missense probably damaging 0.97
R4860:4930435E12Rik UTSW 16 38828145 missense probably damaging 0.97
R5551:4930435E12Rik UTSW 16 38827974 missense probably benign 0.28
R7568:4930435E12Rik UTSW 16 38828447 missense possibly damaging 0.95
R7623:4930435E12Rik UTSW 16 38828091 missense possibly damaging 0.87
R7643:4930435E12Rik UTSW 16 38827863 missense probably benign 0.15
R7669:4930435E12Rik UTSW 16 38828091 missense possibly damaging 0.87
R7670:4930435E12Rik UTSW 16 38828091 missense possibly damaging 0.87
R7671:4930435E12Rik UTSW 16 38828091 missense possibly damaging 0.87
R7924:4930435E12Rik UTSW 16 38812464 nonsense probably null
RF013:4930435E12Rik UTSW 16 38828001 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CATCCCTTTGACCTACAGAAGTG -3'
(R):5'- GGACTGAAGACTCTAGTGATCCAC -3'

Sequencing Primer
(F):5'- CCTTTGACCTACAGAAGTGTATTC -3'
(R):5'- TGATCCACACAGGCTTAGTG -3'
Posted On 2022-04-18