Incidental Mutation 'R9385:Mdc1'
ID 710299
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Name mediator of DNA damage checkpoint 1
Synonyms NFBD1
Accession Numbers
Essential gene? Probably essential (E-score: 0.944) question?
Stock # R9385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 36152407-36170562 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36161396 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 770 (K770E)
Ref Sequence ENSEMBL: ENSMUSP00000080949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337] [ENSMUST00000174124]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082337
AA Change: K770E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607
AA Change: K770E

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174124
SMART Domains Protein: ENSMUSP00000133568
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000225192
AA Change: K178E

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,207,966 (GRCm39) I554T possibly damaging Het
Adamts7 C A 9: 90,077,258 (GRCm39) C1308* probably null Het
Ank2 A G 3: 126,753,366 (GRCm39) V305A probably benign Het
Apob A G 12: 8,056,399 (GRCm39) N1627S possibly damaging Het
Atp10a A T 7: 58,477,887 (GRCm39) Q1310L probably benign Het
Atp8b4 A T 2: 126,322,551 (GRCm39) Y29* probably null Het
Card11 C A 5: 140,871,276 (GRCm39) R742S probably benign Het
Ccdc88a A G 11: 29,405,422 (GRCm39) D365G probably benign Het
Ccdc88b G A 19: 6,833,533 (GRCm39) R211W probably benign Het
Cda T G 4: 138,078,598 (GRCm39) I55L probably benign Het
Cdkl3 A C 11: 51,926,779 (GRCm39) E577D probably benign Het
Cel T C 2: 28,450,587 (GRCm39) D146G probably damaging Het
Cfap251 T C 5: 123,426,878 (GRCm39) L919S probably damaging Het
Cmya5 A G 13: 93,230,880 (GRCm39) S1403P probably damaging Het
Cntn2 G A 1: 132,455,912 (GRCm39) S202L probably damaging Het
Col15a1 C T 4: 47,300,473 (GRCm39) Q1045* probably null Het
Csmd1 T C 8: 16,034,756 (GRCm39) T2472A probably benign Het
Ctbp2 G A 7: 132,601,069 (GRCm39) R22C probably benign Het
Ddit4 A G 10: 59,787,178 (GRCm39) S53P probably damaging Het
Ddx52 G T 11: 83,843,096 (GRCm39) C365F probably damaging Het
Dnhd1 C A 7: 105,361,972 (GRCm39) L3677I probably damaging Het
Dscam T C 16: 96,840,203 (GRCm39) T135A probably benign Het
Espl1 T A 15: 102,207,185 (GRCm39) D216E probably damaging Het
Fsip2 T A 2: 82,819,793 (GRCm39) D5175E possibly damaging Het
Fxr1 A G 3: 34,074,120 (GRCm39) probably benign Het
Fyb1 A G 15: 6,664,297 (GRCm39) D460G probably benign Het
Gm3264 T C 14: 16,058,217 (GRCm39) I8T possibly damaging Het
Gsdmc A T 15: 63,675,486 (GRCm39) Y110N possibly damaging Het
H13 A G 2: 152,537,413 (GRCm39) N286S probably benign Het
H2ac1 A T 13: 24,118,679 (GRCm39) I79F probably damaging Het
Heatr1 A G 13: 12,421,423 (GRCm39) D441G probably damaging Het
Hps6 A G 19: 45,994,349 (GRCm39) D762G probably damaging Het
Hyou1 C A 9: 44,292,812 (GRCm39) Q141K probably benign Het
Lpin3 T C 2: 160,738,993 (GRCm39) I267T probably benign Het
Mlh3 C T 12: 85,316,144 (GRCm39) R14H probably damaging Het
Nfxl1 C A 5: 72,694,750 (GRCm39) V478F probably benign Het
Nhlrc3 A G 3: 53,361,015 (GRCm39) W247R probably damaging Het
Nlrc3 C T 16: 3,781,876 (GRCm39) G527D probably damaging Het
Nop9 A G 14: 55,988,584 (GRCm39) E342G probably benign Het
Ntn1 C A 11: 68,276,013 (GRCm39) G312C probably damaging Het
Opcml T C 9: 28,586,459 (GRCm39) V59A possibly damaging Het
Opn1sw T G 6: 29,379,425 (GRCm39) Y193S probably damaging Het
Or10ad1c C T 15: 98,085,486 (GRCm39) S64N probably damaging Het
Or5p54 T A 7: 107,554,780 (GRCm39) *311K probably null Het
Pabpc4l A T 3: 46,401,137 (GRCm39) V169E probably damaging Het
Pde3a A G 6: 141,437,982 (GRCm39) D1017G probably benign Het
Plagl2 C T 2: 153,074,238 (GRCm39) C221Y probably damaging Het
Plppr4 G T 3: 117,116,377 (GRCm39) N493K possibly damaging Het
Plxna2 T C 1: 194,431,724 (GRCm39) V571A possibly damaging Het
Pnma2 A G 14: 67,153,371 (GRCm39) probably benign Het
Rnf123 T A 9: 107,929,467 (GRCm39) E1234D probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,103,382 (GRCm39) probably benign Het
Slc22a23 T C 13: 34,528,561 (GRCm39) S74G probably benign Het
Slc36a4 T C 9: 15,645,563 (GRCm39) I330T probably damaging Het
Snrk A T 9: 121,995,463 (GRCm39) D414V probably benign Het
Snrnp200 G A 2: 127,079,978 (GRCm39) probably null Het
Spata31d1b T C 13: 59,863,403 (GRCm39) S184P probably damaging Het
Tas2r140 A T 6: 133,032,241 (GRCm39) N172K probably benign Het
Tbc1d4 G T 14: 101,700,356 (GRCm39) Q858K probably damaging Het
Tex55 T G 16: 38,648,407 (GRCm39) D234A probably benign Het
Tial1 A G 7: 128,044,209 (GRCm39) C102R unknown Het
Ugt8a A T 3: 125,665,263 (GRCm39) D411E probably benign Het
Usp34 A G 11: 23,399,223 (GRCm39) D2404G Het
Vmn1r10 A C 6: 57,090,833 (GRCm39) I142L probably benign Het
Wdr97 A G 15: 76,240,367 (GRCm39) T352A Het
Xpo7 A T 14: 70,925,733 (GRCm39) D435E probably damaging Het
Zmym1 A G 4: 126,952,683 (GRCm39) S33P probably damaging Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 36,158,912 (GRCm39) missense probably benign 0.04
IGL01662:Mdc1 APN 17 36,163,397 (GRCm39) missense probably benign 0.00
IGL01931:Mdc1 APN 17 36,159,123 (GRCm39) missense probably benign 0.00
IGL02542:Mdc1 APN 17 36,164,048 (GRCm39) missense probably damaging 0.96
IGL02823:Mdc1 APN 17 36,163,815 (GRCm39) missense probably damaging 0.99
IGL03411:Mdc1 APN 17 36,164,018 (GRCm39) missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 36,157,083 (GRCm39) missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 36,155,361 (GRCm39) missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 36,159,925 (GRCm39) missense probably benign 0.00
R0129:Mdc1 UTSW 17 36,165,337 (GRCm39) missense probably benign 0.04
R0131:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R0131:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R0132:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R1406:Mdc1 UTSW 17 36,164,424 (GRCm39) missense probably benign 0.10
R1406:Mdc1 UTSW 17 36,164,424 (GRCm39) missense probably benign 0.10
R1597:Mdc1 UTSW 17 36,156,758 (GRCm39) missense probably damaging 1.00
R1721:Mdc1 UTSW 17 36,158,718 (GRCm39) missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 36,165,117 (GRCm39) missense probably benign 0.03
R1888:Mdc1 UTSW 17 36,165,117 (GRCm39) missense probably benign 0.03
R1912:Mdc1 UTSW 17 36,161,703 (GRCm39) missense probably benign 0.19
R1912:Mdc1 UTSW 17 36,155,430 (GRCm39) missense probably benign 0.00
R1977:Mdc1 UTSW 17 36,161,822 (GRCm39) missense probably benign 0.01
R2121:Mdc1 UTSW 17 36,158,835 (GRCm39) missense probably benign 0.03
R2122:Mdc1 UTSW 17 36,158,835 (GRCm39) missense probably benign 0.03
R2357:Mdc1 UTSW 17 36,158,337 (GRCm39) missense probably benign 0.00
R2842:Mdc1 UTSW 17 36,159,686 (GRCm39) missense probably benign 0.01
R2851:Mdc1 UTSW 17 36,159,902 (GRCm39) missense probably benign 0.04
R2852:Mdc1 UTSW 17 36,159,902 (GRCm39) missense probably benign 0.04
R2964:Mdc1 UTSW 17 36,164,529 (GRCm39) missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 36,158,785 (GRCm39) unclassified probably benign
R3752:Mdc1 UTSW 17 36,156,821 (GRCm39) missense probably damaging 1.00
R4234:Mdc1 UTSW 17 36,159,716 (GRCm39) missense probably benign 0.00
R4641:Mdc1 UTSW 17 36,168,361 (GRCm39) missense probably benign 0.09
R4706:Mdc1 UTSW 17 36,163,671 (GRCm39) missense probably damaging 0.99
R4809:Mdc1 UTSW 17 36,159,993 (GRCm39) critical splice donor site probably null
R4833:Mdc1 UTSW 17 36,161,286 (GRCm39) missense probably benign 0.20
R5032:Mdc1 UTSW 17 36,161,481 (GRCm39) missense probably benign 0.00
R5047:Mdc1 UTSW 17 36,158,736 (GRCm39) missense probably benign 0.00
R5086:Mdc1 UTSW 17 36,159,522 (GRCm39) missense probably benign 0.00
R5172:Mdc1 UTSW 17 36,163,982 (GRCm39) missense probably benign 0.00
R5254:Mdc1 UTSW 17 36,158,814 (GRCm39) missense probably benign 0.00
R5473:Mdc1 UTSW 17 36,158,952 (GRCm39) missense probably benign 0.01
R5550:Mdc1 UTSW 17 36,156,776 (GRCm39) missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 36,159,438 (GRCm39) missense probably benign 0.00
R5888:Mdc1 UTSW 17 36,158,712 (GRCm39) missense probably benign 0.01
R6020:Mdc1 UTSW 17 36,168,464 (GRCm39) missense probably benign 0.01
R6020:Mdc1 UTSW 17 36,159,525 (GRCm39) missense probably benign 0.04
R6219:Mdc1 UTSW 17 36,161,566 (GRCm39) missense probably benign 0.10
R7053:Mdc1 UTSW 17 36,157,218 (GRCm39) missense probably benign 0.00
R7073:Mdc1 UTSW 17 36,164,960 (GRCm39) missense probably benign 0.18
R7077:Mdc1 UTSW 17 36,156,839 (GRCm39) missense probably damaging 0.97
R7424:Mdc1 UTSW 17 36,164,201 (GRCm39) missense probably benign 0.04
R7443:Mdc1 UTSW 17 36,161,712 (GRCm39) missense probably damaging 0.98
R7467:Mdc1 UTSW 17 36,155,448 (GRCm39) missense probably benign 0.29
R7549:Mdc1 UTSW 17 36,159,749 (GRCm39) missense probably null 0.04
R7655:Mdc1 UTSW 17 36,161,773 (GRCm39) missense probably benign 0.01
R7656:Mdc1 UTSW 17 36,161,773 (GRCm39) missense probably benign 0.01
R7960:Mdc1 UTSW 17 36,161,570 (GRCm39) nonsense probably null
R8350:Mdc1 UTSW 17 36,159,191 (GRCm39) missense probably benign 0.00
R8450:Mdc1 UTSW 17 36,159,191 (GRCm39) missense probably benign 0.00
R8688:Mdc1 UTSW 17 36,161,383 (GRCm39) missense probably benign 0.10
R8726:Mdc1 UTSW 17 36,158,475 (GRCm39) missense probably benign 0.04
R8919:Mdc1 UTSW 17 36,158,843 (GRCm39) missense probably benign 0.00
R8961:Mdc1 UTSW 17 36,159,407 (GRCm39) missense probably benign 0.10
R9324:Mdc1 UTSW 17 36,164,258 (GRCm39) missense probably benign 0.10
R9363:Mdc1 UTSW 17 36,162,019 (GRCm39) missense probably benign 0.00
RF025:Mdc1 UTSW 17 36,165,299 (GRCm39) critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 36,161,829 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGAAGTCTTGGCTACACAG -3'
(R):5'- TCTGTGAGTCTTTGGACATCTC -3'

Sequencing Primer
(F):5'- GCCGTTCTGTCTAAGAGAACAGTC -3'
(R):5'- GTGAGTCTTTGGACATCTCTATTTC -3'
Posted On 2022-04-18