Incidental Mutation 'R9385:Hps6'
ID 710301
Institutional Source Beutler Lab
Gene Symbol Hps6
Ensembl Gene ENSMUSG00000074811
Gene Name HPS6, biogenesis of lysosomal organelles complex 2 subunit 3
Synonyms 5330434M19Rik, BLOC-2, ruby eye, ru
Accession Numbers

MGI: 2181763

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 46003478-46006173 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46005910 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 762 (D762G)
Ref Sequence ENSEMBL: ENSMUSP00000096991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099393]
AlphaFold Q8BLY7
Predicted Effect probably damaging
Transcript: ENSMUST00000099393
AA Change: D762G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096991
Gene: ENSMUSG00000074811
AA Change: D762G

DomainStartEndE-ValueType
Pfam:HPS6 1 772 1e-281 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 5 protein. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 6. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in hypopigmented hair and eyes, and increased clotting time due to a platelet dense granule defect. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Spontaneous(8) Chemically induced(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,161,192 I554T possibly damaging Het
4930435E12Rik T G 16: 38,828,045 D234A probably benign Het
Adamts7 C A 9: 90,195,205 C1308* probably null Het
Ank2 A G 3: 126,959,717 V305A probably benign Het
Apob A G 12: 8,006,399 N1627S possibly damaging Het
Atp10a A T 7: 58,828,139 Q1310L probably benign Het
Atp8b4 A T 2: 126,480,631 Y29* probably null Het
Card11 C A 5: 140,885,521 R742S probably benign Het
Ccdc88a A G 11: 29,455,422 D365G probably benign Het
Ccdc88b G A 19: 6,856,165 R211W probably benign Het
Cda T G 4: 138,351,287 I55L probably benign Het
Cdkl3 A C 11: 52,035,952 E577D probably benign Het
Cel T C 2: 28,560,575 D146G probably damaging Het
Cmya5 A G 13: 93,094,372 S1403P probably damaging Het
Cntn2 G A 1: 132,528,174 S202L probably damaging Het
Col15a1 C T 4: 47,300,473 Q1045* probably null Het
Csmd1 T C 8: 15,984,756 T2472A probably benign Het
Ctbp2 G A 7: 132,999,340 R22C probably benign Het
Ddit4 A G 10: 59,951,356 S53P probably damaging Het
Ddx52 G T 11: 83,952,270 C365F probably damaging Het
Dnhd1 C A 7: 105,712,765 L3677I probably damaging Het
Dscam T C 16: 97,039,003 T135A probably benign Het
Espl1 T A 15: 102,298,750 D216E probably damaging Het
Fsip2 T A 2: 82,989,449 D5175E possibly damaging Het
Fxr1 A G 3: 34,019,971 probably benign Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gm3264 T C 14: 4,871,178 I8T possibly damaging Het
Gm35339 A G 15: 76,356,167 T352A Het
Gsdmc A T 15: 63,803,637 Y110N possibly damaging Het
H13 A G 2: 152,695,493 N286S probably benign Het
Heatr1 A G 13: 12,406,542 D441G probably damaging Het
Hist1h2aa A T 13: 23,934,696 I79F probably damaging Het
Hyou1 C A 9: 44,381,515 Q141K probably benign Het
Lpin3 T C 2: 160,897,073 I267T probably benign Het
Mdc1 A G 17: 35,850,504 K770E probably benign Het
Mlh3 C T 12: 85,269,370 R14H probably damaging Het
Nfxl1 C A 5: 72,537,407 V478F probably benign Het
Nhlrc3 A G 3: 53,453,594 W247R probably damaging Het
Nlrc3 C T 16: 3,964,012 G527D probably damaging Het
Nop9 A G 14: 55,751,127 E342G probably benign Het
Ntn1 C A 11: 68,385,187 G312C probably damaging Het
Olfr288 C T 15: 98,187,605 S64N probably damaging Het
Olfr474 T A 7: 107,955,573 *311K probably null Het
Opcml T C 9: 28,675,163 V59A possibly damaging Het
Opn1sw T G 6: 29,379,426 Y193S probably damaging Het
Pabpc4l A T 3: 46,446,702 V169E probably damaging Het
Pde3a A G 6: 141,492,256 D1017G probably benign Het
Plagl2 C T 2: 153,232,318 C221Y probably damaging Het
Plppr4 G T 3: 117,322,728 N493K possibly damaging Het
Plxna2 T C 1: 194,749,416 V571A possibly damaging Het
Pnma2 A G 14: 66,915,922 probably benign Het
Rnf123 T A 9: 108,052,268 E1234D probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc22a23 T C 13: 34,344,578 S74G probably benign Het
Slc36a4 T C 9: 15,734,267 I330T probably damaging Het
Snrk A T 9: 122,166,397 D414V probably benign Het
Snrnp200 G A 2: 127,238,058 probably null Het
Spata31d1b T C 13: 59,715,589 S184P probably damaging Het
Tas2r140 A T 6: 133,055,278 N172K probably benign Het
Tbc1d4 G T 14: 101,462,920 Q858K probably damaging Het
Tial1 A G 7: 128,442,485 C102R unknown Het
Ugt8a A T 3: 125,871,614 D411E probably benign Het
Usp34 A G 11: 23,449,223 D2404G Het
Vmn1r10 A C 6: 57,113,848 I142L probably benign Het
Wdr66 T C 5: 123,288,815 L919S probably damaging Het
Xpo7 A T 14: 70,688,293 D435E probably damaging Het
Zmym1 A G 4: 127,058,890 S33P probably damaging Het
Other mutations in Hps6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Hps6 APN 19 46003660 missense probably damaging 1.00
IGL02826:Hps6 APN 19 46006041 makesense probably null
stamper-coat UTSW 19 46003836 missense probably damaging 1.00
R0299:Hps6 UTSW 19 46004232 missense probably damaging 0.98
R0613:Hps6 UTSW 19 46003821 missense probably benign
R1036:Hps6 UTSW 19 46004241 missense probably benign 0.00
R1845:Hps6 UTSW 19 46004970 missense probably benign 0.30
R1959:Hps6 UTSW 19 46004335 missense probably benign 0.33
R2271:Hps6 UTSW 19 46005682 missense possibly damaging 0.86
R2332:Hps6 UTSW 19 46004491 missense possibly damaging 0.82
R3156:Hps6 UTSW 19 46003741 missense probably damaging 1.00
R3937:Hps6 UTSW 19 46004053 missense probably damaging 0.97
R7108:Hps6 UTSW 19 46005490 missense probably damaging 1.00
R7384:Hps6 UTSW 19 46004017 missense possibly damaging 0.96
R7710:Hps6 UTSW 19 46004568 missense probably benign 0.03
R8444:Hps6 UTSW 19 46005428 missense possibly damaging 0.72
R8530:Hps6 UTSW 19 46003520 start gained probably benign
R8773:Hps6 UTSW 19 46005702 missense possibly damaging 0.92
R8868:Hps6 UTSW 19 46004007 missense possibly damaging 0.89
R9329:Hps6 UTSW 19 46004103 missense probably benign 0.00
X0065:Hps6 UTSW 19 46004166 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATGAGCTCCTACTTCTGCTGAG -3'
(R):5'- TGTTCCACAACAGACAGTATTGC -3'

Sequencing Primer
(F):5'- ACTTCTGCTGAGGACACATC -3'
(R):5'- ACCTTCGTGCTTCATAACCCTAGG -3'
Posted On 2022-04-18