Incidental Mutation 'R9386:Strc'
ID 710308
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Name stereocilin
Synonyms DFNB16
MMRRC Submission
Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene? Probably non essential (E-score: 0.222) question?
Stock # R9386 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 121363728-121387168 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 121367730 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1449 (E1449K)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000317] [ENSMUST00000038389] [ENSMUST00000078222] [ENSMUST00000129136]
AlphaFold Q8VIM6
Predicted Effect probably benign
Transcript: ENSMUST00000000317
SMART Domains Protein: ENSMUSP00000000317
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 58 133 5.8e-34 PFAM
Pfam:ATP-gua_Ptrans 154 401 4.5e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038389
AA Change: E1449K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: E1449K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078222
SMART Domains Protein: ENSMUSP00000077349
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 1.2e-37 PFAM
Pfam:ATP-gua_Ptrans 154 401 2e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T A 10: 10,398,964 M750L probably benign Het
Ahnak2 T A 12: 112,778,993 H673L Het
Alg1 T C 16: 5,241,337 L338P probably damaging Het
Anapc1 A C 2: 128,617,722 S1806A probably benign Het
Anks1 C T 17: 28,053,906 T925I probably benign Het
Apob G A 12: 8,006,629 A1704T probably damaging Het
Arnt G A 3: 95,488,376 V422M possibly damaging Het
Cblb C A 16: 52,166,338 S648* probably null Het
Cdk18 A G 1: 132,116,445 probably null Het
Celsr1 T C 15: 85,979,030 D1267G probably damaging Het
Chtf18 C T 17: 25,723,758 R399H probably damaging Het
Cntnap1 T A 11: 101,185,226 Y979N probably damaging Het
Col22a1 T C 15: 71,981,945 D256G probably damaging Het
D10Wsu102e T C 10: 83,360,265 F3L probably benign Het
Dbn1 C T 13: 55,481,947 R174Q probably damaging Het
Dnah10 G A 5: 124,794,443 probably null Het
Dnah9 T A 11: 65,947,542 D3143V probably damaging Het
Dnajc6 G A 4: 101,636,901 probably null Het
Doxl2 A G 6: 48,975,390 N83S probably benign Het
Dsg1b A G 18: 20,392,014 N169S possibly damaging Het
Eloa A G 4: 136,010,536 V371A probably benign Het
Epb41l4b A T 4: 57,076,553 V327E probably damaging Het
Fbxo15 A T 18: 84,959,247 T140S probably benign Het
Fryl A T 5: 73,191,809 F3L unknown Het
Galnt16 T C 12: 80,598,106 V501A probably damaging Het
Gm9992 C T 17: 7,369,765 W341* probably null Het
Haus6 A G 4: 86,583,864 I590T probably benign Het
Hcfc2 T A 10: 82,739,103 F199I probably damaging Het
Hoxd13 A G 2: 74,668,983 Y225C probably damaging Het
Hydin T C 8: 110,587,730 L4282P probably benign Het
Ing2 T C 8: 47,674,526 E52G probably benign Het
Itsn2 T C 12: 4,629,730 S180P unknown Het
Kansl1l T C 1: 66,725,970 E727G probably damaging Het
Klhl26 A G 8: 70,451,506 F585L probably benign Het
Lce1a1 T G 3: 92,646,883 S95R unknown Het
Lrp1b A T 2: 41,123,628 V1955E Het
Megf6 G A 4: 154,256,077 G583E probably damaging Het
Mex3a A G 3: 88,536,198 I194V possibly damaging Het
Mmp10 A T 9: 7,503,387 Y116F probably damaging Het
Muc2 A T 7: 141,693,146 D155V probably damaging Het
Ncam2 T C 16: 81,455,364 C232R probably damaging Het
Olfr702 T C 7: 106,824,500 I9V probably benign Het
Pdgfd C A 9: 6,293,903 A159E possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plekha8 C A 6: 54,628,861 T307K probably damaging Het
Pnpla6 T C 8: 3,521,417 probably null Het
Prkdc T G 16: 15,678,272 S776A probably damaging Het
Prrc2b T C 2: 32,214,113 I1201T probably benign Het
Pxmp4 C A 2: 154,588,084 M128I probably benign Het
Siglech T C 7: 55,772,564 S306P probably benign Het
Tchh A T 3: 93,447,039 Q1262L unknown Het
Tln2 A T 9: 67,365,967 D410E possibly damaging Het
Tmem175 A T 5: 108,639,473 Q62L probably benign Het
Tpm3-rs7 A C 14: 113,315,165 M164L probably benign Het
Trav8d-2 G A 14: 53,042,763 R70H probably damaging Het
Tsc1 T C 2: 28,671,846 S332P probably benign Het
Ttc41 T G 10: 86,713,026 I28R probably damaging Het
Vsig10 A C 5: 117,325,075 Y122S probably damaging Het
Wnk2 A G 13: 49,067,346 W1260R probably damaging Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121365060 missense probably benign 0.39
IGL01152:Strc APN 2 121370795 missense probably benign
IGL01608:Strc APN 2 121375594 missense probably benign 0.05
IGL01695:Strc APN 2 121375298 missense probably damaging 1.00
IGL01715:Strc APN 2 121365737 splice site probably null
IGL01906:Strc APN 2 121377634 missense probably benign
IGL02135:Strc APN 2 121364834 missense probably damaging 1.00
IGL02416:Strc APN 2 121369058 missense probably damaging 1.00
IGL02455:Strc APN 2 121375791 unclassified probably benign
IGL03029:Strc APN 2 121364044 missense possibly damaging 0.95
IGL03176:Strc APN 2 121372180 missense probably damaging 0.99
IGL03272:Strc APN 2 121371751 missense probably damaging 1.00
3-1:Strc UTSW 2 121373680 missense probably damaging 0.99
IGL02799:Strc UTSW 2 121379236 missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121375307 missense probably damaging 1.00
R0022:Strc UTSW 2 121368393 missense probably damaging 1.00
R0494:Strc UTSW 2 121379533 missense probably damaging 0.99
R1065:Strc UTSW 2 121366651 missense probably damaging 1.00
R1148:Strc UTSW 2 121372077 intron probably benign
R1148:Strc UTSW 2 121372077 intron probably benign
R1203:Strc UTSW 2 121372123 missense possibly damaging 0.66
R1343:Strc UTSW 2 121365115 missense probably benign 0.21
R1544:Strc UTSW 2 121372738 splice site probably null
R1650:Strc UTSW 2 121380885 start gained probably benign
R1840:Strc UTSW 2 121379296 missense probably damaging 1.00
R1983:Strc UTSW 2 121371037 missense possibly damaging 0.54
R2035:Strc UTSW 2 121374934 missense probably damaging 1.00
R2058:Strc UTSW 2 121378887 missense probably damaging 1.00
R2158:Strc UTSW 2 121365862 missense probably benign 0.10
R2219:Strc UTSW 2 121364523 missense probably damaging 1.00
R2680:Strc UTSW 2 121365111 missense probably damaging 0.99
R4375:Strc UTSW 2 121380823 missense unknown
R4563:Strc UTSW 2 121365805 missense probably benign 0.02
R4578:Strc UTSW 2 121378003 missense possibly damaging 0.94
R4607:Strc UTSW 2 121372945 missense probably benign 0.31
R4651:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4652:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4790:Strc UTSW 2 121375594 missense probably benign 0.05
R5480:Strc UTSW 2 121364819 missense probably benign 0.00
R5580:Strc UTSW 2 121375012 missense probably damaging 0.99
R5679:Strc UTSW 2 121368100 missense probably benign 0.03
R5703:Strc UTSW 2 121370814 missense probably benign
R5841:Strc UTSW 2 121365877 missense probably benign 0.29
R5917:Strc UTSW 2 121379309 missense probably benign
R5958:Strc UTSW 2 121376922 missense possibly damaging 0.56
R6320:Strc UTSW 2 121374958 missense probably benign 0.16
R6619:Strc UTSW 2 121368432 missense probably damaging 0.99
R6695:Strc UTSW 2 121377224 missense probably benign 0.35
R6970:Strc UTSW 2 121378014 missense probably benign 0.41
R7018:Strc UTSW 2 121369058 missense probably damaging 1.00
R7045:Strc UTSW 2 121370726 missense probably damaging 1.00
R7190:Strc UTSW 2 121369026 missense probably benign 0.14
R7283:Strc UTSW 2 121379452 missense probably damaging 0.99
R7694:Strc UTSW 2 121377096 missense probably damaging 1.00
R7699:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7700:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7756:Strc UTSW 2 121370946 missense probably benign
R7758:Strc UTSW 2 121370946 missense probably benign
R7822:Strc UTSW 2 121377738 missense probably benign 0.01
R7830:Strc UTSW 2 121375049 missense probably damaging 0.99
R7953:Strc UTSW 2 121377363 missense probably damaging 0.99
R8137:Strc UTSW 2 121366738 missense probably damaging 0.98
R8394:Strc UTSW 2 121379009 missense probably benign 0.00
R8427:Strc UTSW 2 121377531 missense probably damaging 1.00
R8792:Strc UTSW 2 121377805 missense probably damaging 0.99
R8874:Strc UTSW 2 121374872 critical splice donor site probably null
R8947:Strc UTSW 2 121370989 missense probably benign 0.09
R9285:Strc UTSW 2 121364798 missense probably damaging 1.00
R9302:Strc UTSW 2 121380855 missense unknown
R9438:Strc UTSW 2 121368166 missense probably damaging 1.00
R9581:Strc UTSW 2 121377447 missense probably damaging 0.99
Z1176:Strc UTSW 2 121375521 missense probably damaging 0.98
Z1176:Strc UTSW 2 121379044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACACCCTGATGGACATATG -3'
(R):5'- AAGGCCGGACTTGTTTATGG -3'

Sequencing Primer
(F):5'- CACCCTGATGGACATATGAGTATTTG -3'
(R):5'- GAGTGATTCATTCTATAGCCCAGGC -3'
Posted On 2022-04-18