Incidental Mutation 'R9386:Anapc1'
ID 710309
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Name anaphase promoting complex subunit 1
Synonyms 2610021O03Rik, tsg24, Apc1, Mcpr
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9386 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 128610104-128687391 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 128617722 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 1806 (S1806A)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499]
AlphaFold P53995
Predicted Effect probably benign
Transcript: ENSMUST00000014499
AA Change: S1806A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: S1806A

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T A 10: 10,398,964 M750L probably benign Het
Ahnak2 T A 12: 112,778,993 H673L Het
Alg1 T C 16: 5,241,337 L338P probably damaging Het
Anks1 C T 17: 28,053,906 T925I probably benign Het
Apob G A 12: 8,006,629 A1704T probably damaging Het
Arnt G A 3: 95,488,376 V422M possibly damaging Het
Cblb C A 16: 52,166,338 S648* probably null Het
Cdk18 A G 1: 132,116,445 probably null Het
Celsr1 T C 15: 85,979,030 D1267G probably damaging Het
Chtf18 C T 17: 25,723,758 R399H probably damaging Het
Cntnap1 T A 11: 101,185,226 Y979N probably damaging Het
Col22a1 T C 15: 71,981,945 D256G probably damaging Het
D10Wsu102e T C 10: 83,360,265 F3L probably benign Het
Dbn1 C T 13: 55,481,947 R174Q probably damaging Het
Dnah10 G A 5: 124,794,443 probably null Het
Dnah9 T A 11: 65,947,542 D3143V probably damaging Het
Dnajc6 G A 4: 101,636,901 probably null Het
Doxl2 A G 6: 48,975,390 N83S probably benign Het
Dsg1b A G 18: 20,392,014 N169S possibly damaging Het
Eloa A G 4: 136,010,536 V371A probably benign Het
Epb41l4b A T 4: 57,076,553 V327E probably damaging Het
Fbxo15 A T 18: 84,959,247 T140S probably benign Het
Fryl A T 5: 73,191,809 F3L unknown Het
Galnt16 T C 12: 80,598,106 V501A probably damaging Het
Gm9992 C T 17: 7,369,765 W341* probably null Het
Haus6 A G 4: 86,583,864 I590T probably benign Het
Hcfc2 T A 10: 82,739,103 F199I probably damaging Het
Hoxd13 A G 2: 74,668,983 Y225C probably damaging Het
Hydin T C 8: 110,587,730 L4282P probably benign Het
Ing2 T C 8: 47,674,526 E52G probably benign Het
Itsn2 T C 12: 4,629,730 S180P unknown Het
Kansl1l T C 1: 66,725,970 E727G probably damaging Het
Klhl26 A G 8: 70,451,506 F585L probably benign Het
Lce1a1 T G 3: 92,646,883 S95R unknown Het
Lrp1b A T 2: 41,123,628 V1955E Het
Megf6 G A 4: 154,256,077 G583E probably damaging Het
Mex3a A G 3: 88,536,198 I194V possibly damaging Het
Mmp10 A T 9: 7,503,387 Y116F probably damaging Het
Muc2 A T 7: 141,693,146 D155V probably damaging Het
Ncam2 T C 16: 81,455,364 C232R probably damaging Het
Olfr702 T C 7: 106,824,500 I9V probably benign Het
Pdgfd C A 9: 6,293,903 A159E possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plekha8 C A 6: 54,628,861 T307K probably damaging Het
Pnpla6 T C 8: 3,521,417 probably null Het
Prkdc T G 16: 15,678,272 S776A probably damaging Het
Prrc2b T C 2: 32,214,113 I1201T probably benign Het
Pxmp4 C A 2: 154,588,084 M128I probably benign Het
Siglech T C 7: 55,772,564 S306P probably benign Het
Strc C T 2: 121,367,730 E1449K probably damaging Het
Tchh A T 3: 93,447,039 Q1262L unknown Het
Tln2 A T 9: 67,365,967 D410E possibly damaging Het
Tmem175 A T 5: 108,639,473 Q62L probably benign Het
Tpm3-rs7 A C 14: 113,315,165 M164L probably benign Het
Trav8d-2 G A 14: 53,042,763 R70H probably damaging Het
Tsc1 T C 2: 28,671,846 S332P probably benign Het
Ttc41 T G 10: 86,713,026 I28R probably damaging Het
Vsig10 A C 5: 117,325,075 Y122S probably damaging Het
Wnk2 A G 13: 49,067,346 W1260R probably damaging Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 splice site probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128641537 missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128674593 missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128648488 missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128632627 missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128619917 nonsense probably null
R8402:Anapc1 UTSW 2 128630228 missense probably benign 0.02
R8422:Anapc1 UTSW 2 128675837 missense probably benign
R8425:Anapc1 UTSW 2 128669868 missense probably damaging 1.00
R8469:Anapc1 UTSW 2 128658344 splice site probably null
R8553:Anapc1 UTSW 2 128619913 missense possibly damaging 0.80
R8688:Anapc1 UTSW 2 128685828 missense probably benign 0.19
R8699:Anapc1 UTSW 2 128641453 missense probably damaging 1.00
R8719:Anapc1 UTSW 2 128641449 missense probably damaging 1.00
R8775:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8775-TAIL:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8806:Anapc1 UTSW 2 128622413 missense possibly damaging 0.67
R8973:Anapc1 UTSW 2 128664032 missense probably damaging 0.99
R8977:Anapc1 UTSW 2 128641402 missense probably damaging 1.00
R9000:Anapc1 UTSW 2 128634708 missense probably damaging 1.00
R9080:Anapc1 UTSW 2 128622506 missense possibly damaging 0.82
R9203:Anapc1 UTSW 2 128623502 missense possibly damaging 0.66
R9314:Anapc1 UTSW 2 128622500 missense possibly damaging 0.69
R9415:Anapc1 UTSW 2 128634678 missense probably benign
R9436:Anapc1 UTSW 2 128676125 missense probably benign
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CACCATACCTTGTAGCCACTGG -3'
(R):5'- GCCCTCATGTTGAAGAAAGTGAG -3'

Sequencing Primer
(F):5'- ACTGGTCCAGGGTAGCATCAAC -3'
(R):5'- AGAGGGCTCCTTAGTGTAGTCAAC -3'
Posted On 2022-04-18