Incidental Mutation 'R9386:Adgb'
ID 710337
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Name androglobin
Synonyms 9130014G24Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9386 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 10211447-10348070 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 10274708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 750 (M750L)
Ref Sequence ENSEMBL: ENSMUSP00000136386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045328] [ENSMUST00000132573] [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
AlphaFold G3UZ78
Predicted Effect probably benign
Transcript: ENSMUST00000045328
SMART Domains Protein: ENSMUSP00000045452
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 11 257 1e-165 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132573
SMART Domains Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148816
SMART Domains Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 1 41 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172530
AA Change: M748L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: M748L

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179956
AA Change: M750L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: M750L

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208717
AA Change: M724L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,745,428 (GRCm39) H673L Het
Alg1 T C 16: 5,059,201 (GRCm39) L338P probably damaging Het
Anapc1 A C 2: 128,459,642 (GRCm39) S1806A probably benign Het
Anks1 C T 17: 28,272,880 (GRCm39) T925I probably benign Het
Aoc1l1 A G 6: 48,952,324 (GRCm39) N83S probably benign Het
Apob G A 12: 8,056,629 (GRCm39) A1704T probably damaging Het
Arnt G A 3: 95,395,687 (GRCm39) V422M possibly damaging Het
Cblb C A 16: 51,986,701 (GRCm39) S648* probably null Het
Cdk18 A G 1: 132,044,183 (GRCm39) probably null Het
Celsr1 T C 15: 85,863,231 (GRCm39) D1267G probably damaging Het
Chtf18 C T 17: 25,942,732 (GRCm39) R399H probably damaging Het
Cntnap1 T A 11: 101,076,052 (GRCm39) Y979N probably damaging Het
Col22a1 T C 15: 71,853,794 (GRCm39) D256G probably damaging Het
Dbn1 C T 13: 55,629,760 (GRCm39) R174Q probably damaging Het
Dnah10 G A 5: 124,871,507 (GRCm39) probably null Het
Dnah9 T A 11: 65,838,368 (GRCm39) D3143V probably damaging Het
Dnajc6 G A 4: 101,494,098 (GRCm39) probably null Het
Dsg1b A G 18: 20,525,071 (GRCm39) N169S possibly damaging Het
Eloa A G 4: 135,737,847 (GRCm39) V371A probably benign Het
Epb41l4b A T 4: 57,076,553 (GRCm39) V327E probably damaging Het
Fbxo15 A T 18: 84,977,372 (GRCm39) T140S probably benign Het
Fryl A T 5: 73,349,152 (GRCm39) F3L unknown Het
Galnt16 T C 12: 80,644,880 (GRCm39) V501A probably damaging Het
Haus6 A G 4: 86,502,101 (GRCm39) I590T probably benign Het
Hcfc2 T A 10: 82,574,937 (GRCm39) F199I probably damaging Het
Hoxd13 A G 2: 74,499,327 (GRCm39) Y225C probably damaging Het
Hydin T C 8: 111,314,362 (GRCm39) L4282P probably benign Het
Ing2 T C 8: 48,127,561 (GRCm39) E52G probably benign Het
Itsn2 T C 12: 4,679,730 (GRCm39) S180P unknown Het
Kansl1l T C 1: 66,765,129 (GRCm39) E727G probably damaging Het
Klhl26 A G 8: 70,904,156 (GRCm39) F585L probably benign Het
Lce1a1 T G 3: 92,554,190 (GRCm39) S95R unknown Het
Lrp1b A T 2: 41,013,640 (GRCm39) V1955E Het
Megf6 G A 4: 154,340,534 (GRCm39) G583E probably damaging Het
Mex3a A G 3: 88,443,505 (GRCm39) I194V possibly damaging Het
Mmp10 A T 9: 7,503,388 (GRCm39) Y116F probably damaging Het
Muc2 A T 7: 141,279,389 (GRCm39) D155V probably damaging Het
Ncam2 T C 16: 81,252,252 (GRCm39) C232R probably damaging Het
Nopchap1 T C 10: 83,196,129 (GRCm39) F3L probably benign Het
Or13n4 T C 7: 106,423,707 (GRCm39) I9V probably benign Het
Pdgfd C A 9: 6,293,903 (GRCm39) A159E possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Plekha8 C A 6: 54,605,846 (GRCm39) T307K probably damaging Het
Pnpla6 T C 8: 3,571,417 (GRCm39) probably null Het
Prkdc T G 16: 15,496,136 (GRCm39) S776A probably damaging Het
Prrc2b T C 2: 32,104,125 (GRCm39) I1201T probably benign Het
Pxmp4 C A 2: 154,430,004 (GRCm39) M128I probably benign Het
Siglech T C 7: 55,422,312 (GRCm39) S306P probably benign Het
Strc C T 2: 121,198,211 (GRCm39) E1449K probably damaging Het
Tchh A T 3: 93,354,346 (GRCm39) Q1262L unknown Het
Tln2 A T 9: 67,273,249 (GRCm39) D410E possibly damaging Het
Tmem175 A T 5: 108,787,339 (GRCm39) Q62L probably benign Het
Tpm3-rs7 A C 14: 113,552,597 (GRCm39) M164L probably benign Het
Trav8d-2 G A 14: 53,280,220 (GRCm39) R70H probably damaging Het
Tsc1 T C 2: 28,561,858 (GRCm39) S332P probably benign Het
Ttc41 T G 10: 86,548,890 (GRCm39) I28R probably damaging Het
Unc93a2 C T 17: 7,637,164 (GRCm39) W341* probably null Het
Vsig10 A C 5: 117,463,140 (GRCm39) Y122S probably damaging Het
Wnk2 A G 13: 49,220,822 (GRCm39) W1260R probably damaging Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10,281,843 (GRCm39) missense possibly damaging 0.87
IGL01083:Adgb APN 10 10,283,298 (GRCm39) missense possibly damaging 0.50
IGL03064:Adgb APN 10 10,276,316 (GRCm39) missense probably benign 0.02
R0080:Adgb UTSW 10 10,253,583 (GRCm39) splice site probably benign
R0084:Adgb UTSW 10 10,272,088 (GRCm39) missense possibly damaging 0.74
R0112:Adgb UTSW 10 10,282,902 (GRCm39) splice site probably benign
R0348:Adgb UTSW 10 10,233,623 (GRCm39) missense probably benign
R0415:Adgb UTSW 10 10,306,811 (GRCm39) splice site probably null
R0633:Adgb UTSW 10 10,267,473 (GRCm39) missense probably benign 0.36
R1052:Adgb UTSW 10 10,318,357 (GRCm39) missense probably benign 0.29
R1248:Adgb UTSW 10 10,271,054 (GRCm39) missense probably damaging 0.98
R1278:Adgb UTSW 10 10,258,572 (GRCm39) missense probably damaging 1.00
R1568:Adgb UTSW 10 10,318,409 (GRCm39) nonsense probably null
R1647:Adgb UTSW 10 10,271,115 (GRCm39) missense probably damaging 1.00
R1648:Adgb UTSW 10 10,271,115 (GRCm39) missense probably damaging 1.00
R1663:Adgb UTSW 10 10,215,419 (GRCm39) missense possibly damaging 0.86
R1688:Adgb UTSW 10 10,226,061 (GRCm39) nonsense probably null
R1758:Adgb UTSW 10 10,302,349 (GRCm39) missense probably damaging 1.00
R1772:Adgb UTSW 10 10,258,465 (GRCm39) splice site probably benign
R1850:Adgb UTSW 10 10,318,246 (GRCm39) missense probably damaging 1.00
R1959:Adgb UTSW 10 10,270,993 (GRCm39) missense probably benign 0.02
R1980:Adgb UTSW 10 10,309,242 (GRCm39) missense probably benign
R2179:Adgb UTSW 10 10,271,018 (GRCm39) missense possibly damaging 0.94
R2229:Adgb UTSW 10 10,311,795 (GRCm39) missense probably damaging 1.00
R2283:Adgb UTSW 10 10,253,635 (GRCm39) missense probably damaging 0.99
R2870:Adgb UTSW 10 10,307,025 (GRCm39) critical splice donor site probably null
R2870:Adgb UTSW 10 10,307,025 (GRCm39) critical splice donor site probably null
R2875:Adgb UTSW 10 10,298,463 (GRCm39) missense probably damaging 1.00
R2876:Adgb UTSW 10 10,298,463 (GRCm39) missense probably damaging 1.00
R2920:Adgb UTSW 10 10,265,987 (GRCm39) missense probably damaging 1.00
R2931:Adgb UTSW 10 10,318,246 (GRCm39) missense possibly damaging 0.84
R3722:Adgb UTSW 10 10,216,254 (GRCm39) missense probably benign 0.32
R3846:Adgb UTSW 10 10,258,465 (GRCm39) splice site probably benign
R3877:Adgb UTSW 10 10,318,227 (GRCm39) critical splice donor site probably null
R4210:Adgb UTSW 10 10,283,209 (GRCm39) missense probably benign 0.06
R4211:Adgb UTSW 10 10,283,209 (GRCm39) missense probably benign 0.06
R4333:Adgb UTSW 10 10,318,246 (GRCm39) missense possibly damaging 0.84
R4448:Adgb UTSW 10 10,266,569 (GRCm39) missense probably benign 0.32
R4470:Adgb UTSW 10 10,274,695 (GRCm39) missense probably benign 0.02
R4624:Adgb UTSW 10 10,278,748 (GRCm39) missense probably benign 0.00
R4656:Adgb UTSW 10 10,281,050 (GRCm39) missense probably damaging 0.99
R4676:Adgb UTSW 10 10,302,454 (GRCm39) missense probably damaging 1.00
R4792:Adgb UTSW 10 10,274,647 (GRCm39) missense probably damaging 0.96
R4795:Adgb UTSW 10 10,233,616 (GRCm39) missense probably benign 0.01
R4858:Adgb UTSW 10 10,225,321 (GRCm39) missense probably damaging 1.00
R4985:Adgb UTSW 10 10,276,376 (GRCm39) missense possibly damaging 0.69
R5057:Adgb UTSW 10 10,233,722 (GRCm39) missense probably benign 0.11
R5157:Adgb UTSW 10 10,274,710 (GRCm39) missense probably damaging 1.00
R5209:Adgb UTSW 10 10,274,681 (GRCm39) missense possibly damaging 0.71
R5339:Adgb UTSW 10 10,318,350 (GRCm39) missense probably damaging 1.00
R5376:Adgb UTSW 10 10,222,307 (GRCm39) missense probably benign 0.09
R5426:Adgb UTSW 10 10,226,004 (GRCm39) missense probably benign 0.14
R5516:Adgb UTSW 10 10,306,901 (GRCm39) missense probably damaging 1.00
R5554:Adgb UTSW 10 10,216,217 (GRCm39) missense probably damaging 0.98
R5678:Adgb UTSW 10 10,307,070 (GRCm39) missense possibly damaging 0.83
R5707:Adgb UTSW 10 10,267,501 (GRCm39) missense probably damaging 1.00
R5708:Adgb UTSW 10 10,267,501 (GRCm39) missense probably damaging 1.00
R5891:Adgb UTSW 10 10,253,591 (GRCm39) nonsense probably null
R5928:Adgb UTSW 10 10,254,531 (GRCm39) missense probably damaging 1.00
R6005:Adgb UTSW 10 10,271,096 (GRCm39) missense probably damaging 1.00
R6017:Adgb UTSW 10 10,325,780 (GRCm39) missense probably damaging 1.00
R6049:Adgb UTSW 10 10,253,770 (GRCm39) missense probably damaging 1.00
R6118:Adgb UTSW 10 10,307,035 (GRCm39) missense probably damaging 1.00
R6175:Adgb UTSW 10 10,274,687 (GRCm39) missense possibly damaging 0.94
R6186:Adgb UTSW 10 10,298,502 (GRCm39) missense probably damaging 1.00
R6234:Adgb UTSW 10 10,228,824 (GRCm39) splice site probably null
R6383:Adgb UTSW 10 10,325,772 (GRCm39) missense probably damaging 1.00
R6522:Adgb UTSW 10 10,253,636 (GRCm39) nonsense probably null
R6639:Adgb UTSW 10 10,311,700 (GRCm39) missense possibly damaging 0.51
R6697:Adgb UTSW 10 10,281,870 (GRCm39) nonsense probably null
R6742:Adgb UTSW 10 10,287,593 (GRCm39) missense probably damaging 1.00
R6745:Adgb UTSW 10 10,265,941 (GRCm39) missense probably damaging 1.00
R6850:Adgb UTSW 10 10,270,318 (GRCm39) missense probably benign 0.39
R7128:Adgb UTSW 10 10,347,985 (GRCm39) missense probably benign 0.26
R7326:Adgb UTSW 10 10,276,318 (GRCm39) missense possibly damaging 0.80
R7386:Adgb UTSW 10 10,253,693 (GRCm39) missense possibly damaging 0.52
R7431:Adgb UTSW 10 10,267,699 (GRCm39) splice site probably null
R7569:Adgb UTSW 10 10,306,996 (GRCm39) missense probably benign
R7579:Adgb UTSW 10 10,286,562 (GRCm39) nonsense probably null
R7582:Adgb UTSW 10 10,266,565 (GRCm39) missense probably damaging 1.00
R7615:Adgb UTSW 10 10,311,754 (GRCm39) missense probably damaging 0.96
R7692:Adgb UTSW 10 10,287,456 (GRCm39) critical splice donor site probably null
R7774:Adgb UTSW 10 10,215,404 (GRCm39) nonsense probably null
R7808:Adgb UTSW 10 10,254,403 (GRCm39) splice site probably null
R8158:Adgb UTSW 10 10,254,478 (GRCm39) missense probably benign 0.22
R8386:Adgb UTSW 10 10,226,048 (GRCm39) missense probably damaging 1.00
R8746:Adgb UTSW 10 10,281,028 (GRCm39) critical splice donor site probably null
R8785:Adgb UTSW 10 10,233,710 (GRCm39) missense probably damaging 1.00
R9089:Adgb UTSW 10 10,318,432 (GRCm39) missense probably benign 0.26
R9140:Adgb UTSW 10 10,216,263 (GRCm39) nonsense probably null
R9777:Adgb UTSW 10 10,283,214 (GRCm39) missense possibly damaging 0.74
X0003:Adgb UTSW 10 10,270,374 (GRCm39) missense possibly damaging 0.76
Z1176:Adgb UTSW 10 10,254,486 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGTTCTCAGAGATCACACCTC -3'
(R):5'- AATCTAGGTAGTTATCCCTTCTGTC -3'

Sequencing Primer
(F):5'- GATCACACCTCACCATTTATTAGAGG -3'
(R):5'- TCTGATCAGGCAACTAGC -3'
Posted On 2022-04-18