Incidental Mutation 'R9386:Ttc41'
ID 710340
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R9386 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 86713026 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Arginine at position 28 (I28R)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061458] [ENSMUST00000075632] [ENSMUST00000217747] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000061458
AA Change: I28R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062844
Gene: ENSMUSG00000044937
AA Change: I28R

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Blast:AAA 336 401 9e-8 BLAST
SCOP:d1jpna2 338 370 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000075632
AA Change: I28R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: I28R

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217747
AA Change: I28R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000219108
AA Change: I28R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T A 10: 10,398,964 M750L probably benign Het
Ahnak2 T A 12: 112,778,993 H673L Het
Alg1 T C 16: 5,241,337 L338P probably damaging Het
Anapc1 A C 2: 128,617,722 S1806A probably benign Het
Anks1 C T 17: 28,053,906 T925I probably benign Het
Apob G A 12: 8,006,629 A1704T probably damaging Het
Arnt G A 3: 95,488,376 V422M possibly damaging Het
Cblb C A 16: 52,166,338 S648* probably null Het
Cdk18 A G 1: 132,116,445 probably null Het
Celsr1 T C 15: 85,979,030 D1267G probably damaging Het
Chtf18 C T 17: 25,723,758 R399H probably damaging Het
Cntnap1 T A 11: 101,185,226 Y979N probably damaging Het
Col22a1 T C 15: 71,981,945 D256G probably damaging Het
D10Wsu102e T C 10: 83,360,265 F3L probably benign Het
Dbn1 C T 13: 55,481,947 R174Q probably damaging Het
Dnah10 G A 5: 124,794,443 probably null Het
Dnah9 T A 11: 65,947,542 D3143V probably damaging Het
Dnajc6 G A 4: 101,636,901 probably null Het
Doxl2 A G 6: 48,975,390 N83S probably benign Het
Dsg1b A G 18: 20,392,014 N169S possibly damaging Het
Eloa A G 4: 136,010,536 V371A probably benign Het
Epb41l4b A T 4: 57,076,553 V327E probably damaging Het
Fbxo15 A T 18: 84,959,247 T140S probably benign Het
Fryl A T 5: 73,191,809 F3L unknown Het
Galnt16 T C 12: 80,598,106 V501A probably damaging Het
Gm9992 C T 17: 7,369,765 W341* probably null Het
Haus6 A G 4: 86,583,864 I590T probably benign Het
Hcfc2 T A 10: 82,739,103 F199I probably damaging Het
Hoxd13 A G 2: 74,668,983 Y225C probably damaging Het
Hydin T C 8: 110,587,730 L4282P probably benign Het
Ing2 T C 8: 47,674,526 E52G probably benign Het
Itsn2 T C 12: 4,629,730 S180P unknown Het
Kansl1l T C 1: 66,725,970 E727G probably damaging Het
Klhl26 A G 8: 70,451,506 F585L probably benign Het
Lce1a1 T G 3: 92,646,883 S95R unknown Het
Lrp1b A T 2: 41,123,628 V1955E Het
Megf6 G A 4: 154,256,077 G583E probably damaging Het
Mex3a A G 3: 88,536,198 I194V possibly damaging Het
Mmp10 A T 9: 7,503,387 Y116F probably damaging Het
Muc2 A T 7: 141,693,146 D155V probably damaging Het
Ncam2 T C 16: 81,455,364 C232R probably damaging Het
Olfr702 T C 7: 106,824,500 I9V probably benign Het
Pdgfd C A 9: 6,293,903 A159E possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plekha8 C A 6: 54,628,861 T307K probably damaging Het
Pnpla6 T C 8: 3,521,417 probably null Het
Prkdc T G 16: 15,678,272 S776A probably damaging Het
Prrc2b T C 2: 32,214,113 I1201T probably benign Het
Pxmp4 C A 2: 154,588,084 M128I probably benign Het
Siglech T C 7: 55,772,564 S306P probably benign Het
Strc C T 2: 121,367,730 E1449K probably damaging Het
Tchh A T 3: 93,447,039 Q1262L unknown Het
Tln2 A T 9: 67,365,967 D410E possibly damaging Het
Tmem175 A T 5: 108,639,473 Q62L probably benign Het
Tpm3-rs7 A C 14: 113,315,165 M164L probably benign Het
Trav8d-2 G A 14: 53,042,763 R70H probably damaging Het
Tsc1 T C 2: 28,671,846 S332P probably benign Het
Vsig10 A C 5: 117,325,075 Y122S probably damaging Het
Wnk2 A G 13: 49,067,346 W1260R probably damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGATTGCTTAACCATTGCATCCC -3'
(R):5'- ACTGTCGGAACTGGTTGCTG -3'

Sequencing Primer
(F):5'- TGAAACTGACCAATTGCTTATAGC -3'
(R):5'- CTGGTGAAGGACTTATGGGCC -3'
Posted On 2022-04-18